ID: 921773758

View in Genome Browser
Species Human (GRCh38)
Location 1:219073142-219073164
Sequence GCTAAAGTATGTGTATGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921773758_921773761 10 Left 921773758 1:219073142-219073164 CCTTTGCATACACATACTTTAGC No data
Right 921773761 1:219073175-219073197 AAGTAAGAGTATACAATAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921773758 Original CRISPR GCTAAAGTATGTGTATGCAA AGG (reversed) Intergenic
No off target data available for this crispr