ID: 921774669

View in Genome Browser
Species Human (GRCh38)
Location 1:219082784-219082806
Sequence AGAGACAGCTCAGTGATTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921774669_921774673 27 Left 921774669 1:219082784-219082806 CCCACAATCACTGAGCTGTCTCT No data
Right 921774673 1:219082834-219082856 TTCCATATAGCTGCTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921774669 Original CRISPR AGAGACAGCTCAGTGATTGT GGG (reversed) Intergenic
No off target data available for this crispr