ID: 921774673

View in Genome Browser
Species Human (GRCh38)
Location 1:219082834-219082856
Sequence TTCCATATAGCTGCTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921774669_921774673 27 Left 921774669 1:219082784-219082806 CCCACAATCACTGAGCTGTCTCT No data
Right 921774673 1:219082834-219082856 TTCCATATAGCTGCTGCTGATGG No data
921774671_921774673 4 Left 921774671 1:219082807-219082829 CCTGCAAGCACACATATTCTCTC No data
Right 921774673 1:219082834-219082856 TTCCATATAGCTGCTGCTGATGG No data
921774670_921774673 26 Left 921774670 1:219082785-219082807 CCACAATCACTGAGCTGTCTCTC No data
Right 921774673 1:219082834-219082856 TTCCATATAGCTGCTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921774673 Original CRISPR TTCCATATAGCTGCTGCTGA TGG Intergenic
No off target data available for this crispr