ID: 921774782

View in Genome Browser
Species Human (GRCh38)
Location 1:219084403-219084425
Sequence TAATATGACTGGAGTGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921774782_921774786 -3 Left 921774782 1:219084403-219084425 CCCACTTCACTCCAGTCATATTA No data
Right 921774786 1:219084423-219084445 TTAGGCTGCTTATTGTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921774782 Original CRISPR TAATATGACTGGAGTGAAGT GGG (reversed) Intergenic
No off target data available for this crispr