ID: 921775400 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:219093653-219093675 |
| Sequence | CCATAGCAAAAATGGGCAAA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921775396_921775400 | -5 | Left | 921775396 | 1:219093635-219093657 | CCTCAAAAACAGAGATAACCATA | No data | ||
| Right | 921775400 | 1:219093653-219093675 | CCATAGCAAAAATGGGCAAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921775400 | Original CRISPR | CCATAGCAAAAATGGGCAAA TGG | Intergenic | ||
| No off target data available for this crispr | |||||