ID: 921775400

View in Genome Browser
Species Human (GRCh38)
Location 1:219093653-219093675
Sequence CCATAGCAAAAATGGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921775396_921775400 -5 Left 921775396 1:219093635-219093657 CCTCAAAAACAGAGATAACCATA No data
Right 921775400 1:219093653-219093675 CCATAGCAAAAATGGGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921775400 Original CRISPR CCATAGCAAAAATGGGCAAA TGG Intergenic
No off target data available for this crispr