ID: 921780121

View in Genome Browser
Species Human (GRCh38)
Location 1:219153091-219153113
Sequence AATTGTGACTGGAGTGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921780121_921780127 3 Left 921780121 1:219153091-219153113 CCCTCTACACTCCAGTCACAATT No data
Right 921780127 1:219153117-219153139 CTTATTGGAGCAGGTGGCTCTGG No data
921780121_921780125 -6 Left 921780121 1:219153091-219153113 CCCTCTACACTCCAGTCACAATT No data
Right 921780125 1:219153108-219153130 ACAATTGTACTTATTGGAGCAGG No data
921780121_921780126 -3 Left 921780121 1:219153091-219153113 CCCTCTACACTCCAGTCACAATT No data
Right 921780126 1:219153111-219153133 ATTGTACTTATTGGAGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921780121 Original CRISPR AATTGTGACTGGAGTGTAGA GGG (reversed) Intergenic
No off target data available for this crispr