ID: 921782998

View in Genome Browser
Species Human (GRCh38)
Location 1:219190865-219190887
Sequence CACTCAGTAGTTGCTTGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 2, 2: 0, 3: 12, 4: 128}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921782994_921782998 28 Left 921782994 1:219190814-219190836 CCACTTATGTGGAGTTTTAGAAC 0: 1
1: 1
2: 1
3: 27
4: 192
Right 921782998 1:219190865-219190887 CACTCAGTAGTTGCTTGGGAAGG 0: 1
1: 2
2: 0
3: 12
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921782998 Original CRISPR CACTCAGTAGTTGCTTGGGA AGG Intronic
900572455 1:3365280-3365302 CACACAGTAGGTGCTTGGTAGGG - Intronic
900589361 1:3452960-3452982 CACTCAGCGTGTGCTTGGGATGG - Intergenic
901460893 1:9391031-9391053 CAGTCAGAAGCTGCTTGGGGAGG - Intergenic
901780967 1:11594226-11594248 CCCTCAGTGGTTGCTGGGGAAGG + Intergenic
901944156 1:12687427-12687449 CACACAGTAGTTGCTAAGGGTGG + Intergenic
904329802 1:29751167-29751189 CACTCAGTGCTTTCTTGGAAGGG + Intergenic
906085202 1:43127091-43127113 CCCTCCCTAGTTCCTTGGGAGGG - Intergenic
906903223 1:49860946-49860968 CACTCTGTAGCTGCCTGGGTTGG - Intronic
908399378 1:63756071-63756093 GACTCAGGAGTTTCCTGGGAGGG - Intergenic
908773156 1:67614302-67614324 CACTCAGTAATTCCTTGAGTAGG - Intergenic
913243826 1:116853960-116853982 CACTCAGAAGTTGGTGGGGGTGG - Intergenic
921555591 1:216594898-216594920 GACTCAGTAGTACCTTGGTAGGG + Intronic
921782998 1:219190865-219190887 CACTCAGTAGTTGCTTGGGAAGG + Intronic
923902239 1:238338938-238338960 CAATCAGTGGTTGCTGGGGTTGG - Intergenic
923902249 1:238338996-238339018 CAATCAGTGGTTGCTGGGGTTGG - Intergenic
924952468 1:248897600-248897622 CAGTCAGCAGCTGCTCGGGAAGG + Intergenic
1067298502 10:44989783-44989805 CAGTCAGTGGTTGGTGGGGAGGG - Intronic
1071140126 10:82500037-82500059 CAGGCTGTAGTTGCTTGAGAAGG + Intronic
1071780830 10:88842653-88842675 AACTCTGCAGATGCTTGGGAAGG - Intronic
1072677249 10:97477087-97477109 CACTGAGTACTTTCTTGGAATGG - Intronic
1073798528 10:107014947-107014969 CTCTTAGTAGTTGCAAGGGAAGG - Intronic
1082894559 11:58176297-58176319 CACTCAGTGGGTGCATGGCAGGG + Intronic
1087006868 11:93479812-93479834 CACACGGTGGGTGCTTGGGAAGG - Intronic
1092947783 12:13472731-13472753 CCCTCAGTAGTATCTTGGGTTGG - Intergenic
1094478611 12:30862046-30862068 GACTCAGTGGTTGCATGGCAAGG + Intergenic
1096417883 12:51429360-51429382 CACTCACTAAGTGTTTGGGAAGG + Intronic
1096526755 12:52214619-52214641 CACCCAGTAGGTGCTTCGGGAGG - Intergenic
1099985274 12:89655265-89655287 CTCTCAGTAGTTGATTGAGTTGG - Intronic
1100176551 12:92037373-92037395 TAATCAGTAGTTCCTTTGGATGG - Intronic
1100266106 12:92978184-92978206 CCCCCAGTGGTTCCTTGGGAAGG + Intergenic
1101717343 12:107321897-107321919 CCCTCAGTATTTCCTTTGGAAGG + Intronic
1103012035 12:117465243-117465265 CACTCTGGGGTTGCTGGGGATGG - Exonic
1103059585 12:117847796-117847818 CACTCAGAAGTGCCTTGGGACGG - Intronic
1111823759 13:93243930-93243952 CACTCAGATGTTGCTGGTGATGG + Intronic
1113583028 13:111441988-111442010 CACTGTGTAGTTGCTTAGGATGG - Intergenic
1118305168 14:64649543-64649565 CACTCGGAAGGTGCTCGGGAGGG - Intergenic
1123498088 15:20850589-20850611 CACTTAATATTTGTTTGGGAAGG + Intronic
1123555319 15:21424217-21424239 CACTTAATATTTGTTTGGGAAGG + Intronic
1123591562 15:21861548-21861570 CACTTAATATTTGTTTGGGAAGG + Intergenic
1126830968 15:52604526-52604548 CAGTCAGTAGTTAGTTGGTATGG - Intronic
1129778378 15:78252235-78252257 CACTCAGCAGGTGCGTGGGTGGG - Intergenic
1130430452 15:83842064-83842086 CTCTCAGTAGATGGATGGGAAGG - Intronic
1132371388 15:101301851-101301873 AAGTCAGTAGTGGCCTGGGAGGG + Intronic
1202963665 15_KI270727v1_random:151426-151448 CACTTAATATTTGTTTGGGAAGG + Intergenic
1134030913 16:10991596-10991618 GACTCAGGAGTTGCTGTGGAAGG + Intronic
1137006126 16:35275658-35275680 CTCTCATTAGTTGTTTGGGCTGG - Intergenic
1139064494 16:63295714-63295736 CACTCATTATTTTCTTGGGCTGG + Intergenic
1139721653 16:68860925-68860947 CCCTCATTAAATGCTTGGGAGGG + Intronic
1140893233 16:79302985-79303007 CACTCCGGAGTTGCTTCTGACGG + Intergenic
1142673616 17:1499650-1499672 GCCACAGTAGTTGCTTCGGAAGG - Intronic
1146577651 17:34008810-34008832 AACTCTGTACATGCTTGGGATGG - Intronic
1146708364 17:35019026-35019048 CAATCAATAGTTGCTAGGCAAGG - Intronic
1151482695 17:74379713-74379735 CACCGAGTAGTTGGGTGGGAGGG + Intergenic
1155589673 18:27412094-27412116 AAGTCAGTGGTTCCTTGGGAAGG + Intergenic
1156495334 18:37521856-37521878 TACTCAGAAGTTGCATGAGATGG - Intronic
1156868006 18:41909917-41909939 CACTCACTAGGTGGTGGGGAGGG + Intergenic
1159106255 18:64004279-64004301 CACTCAGTATTTGCTTAGCATGG + Intronic
1160797888 19:954182-954204 CACTCAGCAGTTGGGTGGGGTGG - Intronic
1162056747 19:8069019-8069041 CACTCAGAAATGTCTTGGGATGG + Intronic
1166254404 19:41592166-41592188 CACTCAGTGGATGCTGGGAATGG + Intronic
1166408054 19:42537407-42537429 CCCTCAGCTTTTGCTTGGGAAGG + Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
931186166 2:59953415-59953437 CACTAAGTAGTTGCGTGGCCTGG - Intergenic
933941521 2:87248823-87248845 CACACAGCACTTGCCTGGGAGGG - Intergenic
934776295 2:96939735-96939757 CACACAGTAGGAGCTTGGGCAGG + Intronic
936338703 2:111612768-111612790 CACACAGCACTTGCCTGGGAGGG + Intergenic
937552842 2:123115678-123115700 CACACAGTAGTTGTGGGGGAGGG + Intergenic
943593613 2:189829172-189829194 TACTGAGTAGGTGCTTTGGAAGG + Intronic
946727601 2:222676126-222676148 AGATCAGTGGTTGCTTGGGAAGG - Intronic
1169668670 20:8069527-8069549 CTCTCATTAGTTGCACGGGATGG + Intergenic
1171992420 20:31707006-31707028 CACACAGTAGGTGCTTGACATGG - Intronic
1172175755 20:32970940-32970962 CACACAGCAGCTGCTGGGGAAGG + Intergenic
1172438749 20:34950308-34950330 CACTCAGTAATTGTTTGCTAAGG - Intronic
1175657720 20:60786627-60786649 CACCCAGCAGCTGGTTGGGAAGG - Intergenic
1175752077 20:61505584-61505606 CACTCAGCACTTGCTTAGGAAGG + Intronic
1176818077 21:13626322-13626344 CACTTAATATTTGTTTGGGAAGG - Intronic
1178000594 21:28158387-28158409 CACTGAGGAGTTGCTTGGTGGGG - Intergenic
1178349045 21:31858347-31858369 GACTCAGAAGTCCCTTGGGAAGG + Intergenic
1178385052 21:32142251-32142273 CACTGAGTAATTGCTTTAGATGG + Intergenic
1179210125 21:39317408-39317430 CAGTCAGGAGTTGCTTGCCACGG - Intronic
1183743351 22:39680091-39680113 CACACAGTAGGTGCTTGGGTAGG + Intronic
1183930329 22:41232428-41232450 CACCCAGAAGATGCTCGGGAAGG - Intronic
951520206 3:23604350-23604372 CACTCGGTGGGTGCTAGGGATGG - Intergenic
951881566 3:27484868-27484890 GACTCGTTAGTTGCTTCGGAGGG - Intergenic
953851821 3:46470495-46470517 CACTCAGTAGGAGCCTGAGATGG + Intronic
956327121 3:68066052-68066074 AGATCAGTAGTTACTTGGGAGGG + Intronic
957230729 3:77510836-77510858 CACGGAGTAATTGCTTGGAATGG + Intronic
957330248 3:78754320-78754342 CACTCAGGAGTAGCCTGGCAGGG + Intronic
957334143 3:78805035-78805057 CAGTCAATAGTTACTTGGAAAGG - Intronic
962347556 3:134629527-134629549 CCCTCAGAAGATGCTTGGGCTGG + Intronic
962805136 3:138921716-138921738 AACTCAGTAGTGGCTAGGGCTGG + Intergenic
963046056 3:141103484-141103506 GACTCAGTTGGTGCCTGGGAAGG + Intronic
964788477 3:160426967-160426989 CTCTCATTAGTTCTTTGGGATGG - Intronic
965906974 3:173720487-173720509 CACACATTATTTGCTTAGGAAGG + Intronic
967191399 3:186988060-186988082 CACTGAGGAGATACTTGGGATGG - Intronic
968496158 4:917605-917627 CAATCAGTGGTTTCCTGGGATGG + Intronic
969574138 4:8026568-8026590 CACTCAGCAGCTGCTCAGGATGG + Intronic
976277796 4:83295237-83295259 CACCCACTAGTTGCTTTGCAAGG + Exonic
980829390 4:138111569-138111591 CACTGAGTAGGTTCTTGGGTGGG + Intergenic
982840752 4:160182651-160182673 CAATCAGAAGTTCCTTGGAATGG - Intergenic
986849417 5:11793650-11793672 CTCTCAGCAGGTGCTAGGGAAGG - Intronic
993706207 5:91173848-91173870 CACTAAATGGTTGCTCGGGAAGG + Intergenic
996546971 5:124690198-124690220 AGATCAGTAGTTGCTAGGGATGG + Intronic
997453699 5:134003147-134003169 CACACAGTAGGTGCTTGAGAAGG - Intronic
999010812 5:148037681-148037703 CACTCAGGAGTTGGTAGTGATGG - Intronic
999750082 5:154621691-154621713 CGCTCAGGAGTAGCTGGGGAGGG - Intergenic
1002255074 5:177952538-177952560 AAATCAGTGGCTGCTTGGGATGG - Intergenic
1002483009 5:179515870-179515892 AAATCAGTGGCTGCTTGGGATGG + Intergenic
1003072394 6:2955565-2955587 CACGCAGTACTTGCTTAGGATGG - Exonic
1007196439 6:40065459-40065481 AACTCAGTAGTTGTTTCTGAGGG + Intergenic
1007739120 6:44000434-44000456 CACTCAGTAGGTTGTAGGGAAGG + Intergenic
1008975882 6:57426254-57426276 CACTCAGTGGTTGCTTGGGACGG - Intronic
1009164410 6:60323377-60323399 CACTCAGTGGTTGCTTGGGACGG - Intergenic
1011660040 6:89586866-89586888 AACTCAGTAATTGCTAGGGTTGG - Intronic
1017168129 6:151429016-151429038 CACACAGTAGGTGGTCGGGAAGG - Intronic
1018370566 6:163164478-163164500 CACTCAGTGGGCGCTGGGGATGG + Intronic
1018439984 6:163803017-163803039 AGATCAGTGGTTGCTTGGGATGG + Intergenic
1026847221 7:73704990-73705012 CACTCAGCAGCTACTTGGCAAGG - Intronic
1028170405 7:87589158-87589180 CACTCTGTAGTTTATTAGGAAGG + Intronic
1029597381 7:101545106-101545128 CACTTAGTGGCAGCTTGGGAGGG - Intronic
1029802919 7:102968758-102968780 CATGCTATAGTTGCTTGGGAGGG + Intronic
1030295136 7:107917412-107917434 CACCCTGAAGTTGCTTGGGTTGG + Exonic
1031001952 7:116425754-116425776 CGATCAGTAGTTCCTGGGGAAGG - Intronic
1031192320 7:118569257-118569279 CATTCAGTAATTGCTCAGGATGG + Intergenic
1032075651 7:128834765-128834787 AGATCAGTTGTTGCTTGGGATGG + Intronic
1036671717 8:10793053-10793075 CACTCAGTAGATGTTAGCGAGGG - Intronic
1038341797 8:26692520-26692542 CAGTCTATAGTAGCTTGGGATGG - Intergenic
1047936116 8:129780581-129780603 CTCTCAGTTTTTGTTTGGGAAGG - Intronic
1050853890 9:10325080-10325102 CACTGAGTAGTAGATTGGGGAGG - Intronic
1052587531 9:30448566-30448588 CATTCAATAGTTGCTTGACAAGG + Intergenic
1052930229 9:34049655-34049677 CACCCAGAAGGGGCTTGGGAGGG - Intergenic
1055493285 9:76827942-76827964 CACTCAGTAATTGTTTGTGAGGG - Intronic
1056831074 9:89918029-89918051 CACTCAGTCATTGCTTCAGAGGG + Intergenic
1059642755 9:116233862-116233884 GCCTCAGTGGTTGGTTGGGAGGG - Intronic
1061258406 9:129466075-129466097 CACACAGTAGGTGCTCAGGAAGG - Intergenic
1061486126 9:130921319-130921341 AACTCAGTTTTTGTTTGGGAAGG - Intronic
1203529282 Un_GL000213v1:123182-123204 CACTTAATATTTGTTTGGGAAGG + Intergenic
1195666593 X:107437000-107437022 TACTCAGTATTTGCTTTGGAAGG - Intergenic
1198054769 X:132982977-132982999 CCCACAGTAGTTGGTTTGGAAGG + Intergenic
1200224478 X:154409518-154409540 CAGTCAGCAGTTGCTGGGGAAGG + Exonic
1200242966 X:154507389-154507411 CACCAAGTAGGTGCTTGGGGAGG - Exonic
1201331609 Y:12828685-12828707 CACAAAGTGGTTGCTTGAGATGG + Intronic
1201396597 Y:13555218-13555240 CACCCAGTAGTTGCATTTGAGGG - Intergenic