ID: 921784335

View in Genome Browser
Species Human (GRCh38)
Location 1:219210338-219210360
Sequence GTGGTGACATAGAGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 253}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921784328_921784335 11 Left 921784328 1:219210304-219210326 CCTGGCTCCTTGTAGAGCACAGC 0: 1
1: 0
2: 0
3: 14
4: 188
Right 921784335 1:219210338-219210360 GTGGTGACATAGAGGGAACAGGG 0: 1
1: 0
2: 3
3: 20
4: 253
921784329_921784335 4 Left 921784329 1:219210311-219210333 CCTTGTAGAGCACAGCTCTCTTT 0: 1
1: 0
2: 0
3: 11
4: 161
Right 921784335 1:219210338-219210360 GTGGTGACATAGAGGGAACAGGG 0: 1
1: 0
2: 3
3: 20
4: 253

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921784335 Original CRISPR GTGGTGACATAGAGGGAACA GGG Intronic
900002269 1:21249-21271 ATGGTGACAGATAGGGAACGAGG - Intergenic
900021988 1:191773-191795 ATGGTGACAGATAGGGAACGAGG - Intergenic
901268594 1:7932602-7932624 AGAGGGACATAGAGGGAACATGG + Intronic
901625854 1:10624654-10624676 GAGGTGACATAGAGAGAGAAAGG - Intronic
901821197 1:11830638-11830660 GTGGTTACAGAGAAGCAACAAGG - Intronic
903176591 1:21585228-21585250 GTGGGGACAGGAAGGGAACATGG + Intergenic
907576143 1:55527684-55527706 GAGGTGACATTTAGGGAAGAAGG + Intergenic
907746857 1:57222367-57222389 GTGTTGTTATAGAGGAAACATGG + Intronic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
911038440 1:93573502-93573524 ATGGAGACAAAGAGGGAAAATGG - Intronic
911351234 1:96758389-96758411 GTGGTTTCATAAAGTGAACAGGG - Intronic
912511847 1:110195105-110195127 GGAGTGACAAAGATGGAACAGGG - Intronic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
914240678 1:145850650-145850672 GAGGGGACAGAGAGGGAACCTGG - Intronic
914874712 1:151504341-151504363 GTGGTGAGATACAAGGAACTTGG + Intergenic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915716218 1:157947564-157947586 GTTTTGACAGAGAAGGAACAAGG + Intergenic
917058035 1:171004768-171004790 CTGGTGACAAGGAGGGATCATGG - Intronic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
917511645 1:175674046-175674068 CTGGTGGCAAAGAGGAAACAAGG + Intronic
919011529 1:191971879-191971901 TTGGTGATATAAAGGGAACAGGG - Intergenic
919270795 1:195341761-195341783 AGGGTGCCATAGTGGGAACATGG - Intergenic
919752483 1:201047000-201047022 ATGGAGACATAGAGGGAAAAAGG - Intronic
920213350 1:204344940-204344962 GGGGTGACATACAGGGAATGAGG - Intronic
921088817 1:211823428-211823450 GTGGTGACAGGGAGGGAATAGGG - Intronic
921784335 1:219210338-219210360 GTGGTGACATAGAGGGAACAGGG + Intronic
923087291 1:230711296-230711318 GTGGGGACACAGAGAGAAGACGG + Intronic
923425233 1:233862208-233862230 TTGGTGACATAGAAGTCACAGGG + Intergenic
1063607955 10:7539554-7539576 GTGGTGAGAAAGAGAGAAGATGG + Intergenic
1067015858 10:42755800-42755822 GTGGTGACAGGCAGGGAATATGG - Intergenic
1067155495 10:43777750-43777772 GTGTAGACACAAAGGGAACAAGG - Intergenic
1068160612 10:53258332-53258354 GTGGTGAGGTAGAGTCAACATGG + Intergenic
1069658183 10:70105812-70105834 GCAGTGACAAAGAGGGAAAAAGG + Intronic
1070268342 10:74926665-74926687 GAGATTACATGGAGGGAACAAGG - Intronic
1071341687 10:84654680-84654702 CTGGGGACATAGAGGGTAAAAGG - Intergenic
1072572151 10:96667858-96667880 TTTGCGCCATAGAGGGAACAGGG + Intronic
1074435149 10:113427441-113427463 GAGGTGACAGAGAGGGAAGGAGG - Intergenic
1075930117 10:126288611-126288633 GTGGTGACATAGTGGCCCCAAGG + Intronic
1077344209 11:2038971-2038993 GGGGTGGCATGGAGGGCACAGGG + Intergenic
1077895998 11:6453969-6453991 GTGGCGACATAGAGGGCAGGTGG + Intronic
1078470488 11:11582123-11582145 GAGGTGACATATGGGGAAGAGGG + Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078935179 11:15943260-15943282 TTGGTGACAGAGAGGAAAGAGGG + Intergenic
1080442650 11:32309387-32309409 GTGGGGACATAGATGAGACAAGG - Intergenic
1081417739 11:42835990-42836012 GTGAAGACATAGAGGAAATATGG - Intergenic
1083986493 11:66219211-66219233 GTGGTGTCACAGATGGAAAAGGG + Intronic
1087400546 11:97660021-97660043 GTGATAACATAGAGGAAACTTGG - Intergenic
1090096031 11:123742372-123742394 GTGGTGACTTACAGGGTAAAAGG - Intergenic
1090374158 11:126277269-126277291 GTTGTGACATGGAGGGACTACGG - Intronic
1090632542 11:128662820-128662842 GAGGTGATCTAAAGGGAACATGG - Intergenic
1090716852 11:129438723-129438745 GTTGTGACAGAAAGGGATCATGG + Intronic
1090864944 11:130691408-130691430 GTGGAGAGAGAGAGGGAGCAAGG - Intronic
1202827195 11_KI270721v1_random:94160-94182 GGGGTGGCATGGAGGGCACAGGG + Intergenic
1091375687 12:23311-23333 ATGGTGACAGATAGGGAACGAGG - Intergenic
1092178822 12:6430455-6430477 GTGGTGACATAAGGGTAAAAAGG + Intergenic
1094213865 12:27920514-27920536 GTGCTGAAATAGCGGGGACAGGG - Intergenic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1098089609 12:66886982-66887004 ATGGTGAGATAGAGTGAAAAGGG - Intergenic
1098167784 12:67715809-67715831 GTGATGGCAAAGAGGGAAGAGGG + Intergenic
1098449433 12:70602672-70602694 GTGGGGATATAGATGAAACAAGG + Intronic
1101481966 12:105107345-105107367 GTGGCGACAGAGAGGGAAACAGG + Intronic
1102208706 12:111108665-111108687 GTGGAGACAGAGAGGGGAGATGG - Intronic
1102438001 12:112940232-112940254 CTGCTGACAAAGTGGGAACAGGG - Intronic
1104677775 12:130726081-130726103 GTGGTGAGATTGAGAGAAAAGGG + Intergenic
1105811793 13:24001913-24001935 ATGGTGAGATAAAGGGGACATGG + Intronic
1106313514 13:28574416-28574438 GTTGTGACACAGTGGGCACATGG + Intergenic
1106463733 13:29994634-29994656 GTGGGCTCATAGAGGGAACTGGG - Intergenic
1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG + Intronic
1107363278 13:39642588-39642610 GTGGTGATACAGGGGTAACAGGG + Intergenic
1107632047 13:42352099-42352121 GTGGTGACAAAGAAGGCACAGGG + Intergenic
1107646554 13:42500007-42500029 GTGGAGACAGAGAGGCAAGACGG - Intergenic
1108012481 13:46033040-46033062 GTGGTTACCTACAGGGAAAAGGG + Intronic
1108192103 13:47952211-47952233 GTGGTGACATCGAAGGACCAAGG - Intronic
1112255968 13:97831503-97831525 GTGGAGACTTAGAGGGAGCTAGG - Intergenic
1113242552 13:108354680-108354702 GTGTTGACATTGAGGTAGCATGG + Intergenic
1114092667 14:19303027-19303049 GTGGTGACAGGCAGGGAATATGG - Intergenic
1116955720 14:50921110-50921132 GTGATGACATAGGTTGAACAAGG + Intronic
1117448642 14:55829150-55829172 GTGGTGACACAGAGGTTAGAAGG + Intergenic
1117602401 14:57389838-57389860 GTGGTGAAAGAGAGTGACCAGGG - Intergenic
1117748047 14:58891518-58891540 GGAATGACATAGAGGGGACAGGG - Intergenic
1120775491 14:88431752-88431774 GTGGCAACATGGATGGAACATGG - Intronic
1122356230 14:101124521-101124543 GTGGGGACATAAAGGGGACTGGG - Intergenic
1122363413 14:101180776-101180798 GGGGTGACCCAGAGGGAGCAGGG - Intergenic
1124943732 15:34243308-34243330 GTGAAGACAGAAAGGGAACAAGG + Intronic
1125933403 15:43615816-43615838 GTGGTGGCAGAGAGGGCAGAAGG + Exonic
1125946501 15:43715278-43715300 GTGGTGGCAGAGAGGGCAGAAGG + Intergenic
1131574452 15:93572589-93572611 GTTGAGACATAAAGGGAACCTGG - Intergenic
1131760756 15:95620168-95620190 GTGGTGACAGTGGGAGAACATGG - Intergenic
1132451242 15:101969690-101969712 ATGGTGACAGATAGGGAACGAGG + Intergenic
1133297703 16:4762943-4762965 GTGGTGACAGGGAGAGACCATGG - Intronic
1134075774 16:11290401-11290423 GTGGGGACAAGGGGGGAACAAGG + Intronic
1135105573 16:19646251-19646273 GTGGTGAGAAAGAGAGGACATGG - Intronic
1136609687 16:31358699-31358721 GGGGTGACATTGAGGGAGGAAGG + Intronic
1137016151 16:35377446-35377468 GGGGTGACAGTGAGGGAAAAAGG + Intergenic
1137507343 16:49065617-49065639 GTGGTGACTTAGGGAGAGCAGGG + Intergenic
1137833593 16:51568800-51568822 GTGCTAACATAGAAGGAACCAGG - Intergenic
1138955215 16:61963251-61963273 ATGGTGACATGGAAGGGACATGG - Intronic
1139090255 16:63637564-63637586 GTGGGGACATAGAGGGATGTGGG + Intergenic
1139110716 16:63887248-63887270 GTGGTAACATAGAGAGAGCAAGG + Intergenic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1143259581 17:5588105-5588127 GTGGTGACAGAGAGGACACCTGG - Intronic
1143962729 17:10733966-10733988 AAGGTGACATATTGGGAACAAGG + Intergenic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1144366236 17:14547535-14547557 GTGGTGACATGGAGGAAAGTTGG + Intergenic
1145187943 17:20812004-20812026 TTTGTGAGATAGAGGGAAAATGG + Intergenic
1146941275 17:36845984-36846006 GTGGGGACAGAGAGGGGAGAGGG + Intergenic
1147609251 17:41792060-41792082 GTGGGGAGATAGAGGCAGCATGG + Intergenic
1149269080 17:54956839-54956861 GGGGTGATAGAGAGGGAAGAGGG + Intronic
1150619339 17:66797693-66797715 GTGGGGACACAGAGGGGAGAAGG - Intronic
1150945867 17:69744918-69744940 GAGGTGAGGTTGAGGGAACAGGG + Intergenic
1151854115 17:76709733-76709755 GTGGTGAACTCCAGGGAACATGG + Intronic
1156052378 18:32952507-32952529 GTGGCCACATAGAAAGAACATGG - Intronic
1156566625 18:38198608-38198630 GTGAAGACATAGAGAGAAAATGG - Intergenic
1157937851 18:51892944-51892966 GTGGCAACAGAGAGGGAAGATGG + Intergenic
1158221900 18:55159267-55159289 CTGATGCCATAGAGGGAACCAGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1160634022 19:62857-62879 ATGGTGACAGATAGGGAACGAGG - Intergenic
1161477779 19:4495972-4495994 GGAGTGACAGAGAGAGAACACGG - Intronic
1162601695 19:11674565-11674587 CTGGTGAGAAAGAGGGAACTGGG - Intergenic
1163669811 19:18620835-18620857 GAGGGGACATAGAAGGAAAAAGG - Exonic
1163817421 19:19475389-19475411 GTGGTCACACAAAGGGAAAATGG - Intronic
1165486764 19:36101180-36101202 GTGGGGGCAGAGAGGGAACAAGG - Intronic
1167211043 19:48134275-48134297 GTGGTGACAGATAGGGAACAGGG - Intronic
1167567693 19:50267199-50267221 GTCGTGACGTACAGGGAGCAGGG + Intronic
925359577 2:3268104-3268126 GTGGGGTCACAGAGGGACCAAGG - Intronic
927062294 2:19435165-19435187 TTTGTGAGATAGAGGGAACTTGG - Intergenic
929760286 2:44801197-44801219 GAGGTGACAGAGAAGGAAAAAGG + Intergenic
932605452 2:73162868-73162890 GTGGGGCCAGAGAGGGAAGAAGG + Intergenic
933246891 2:79985913-79985935 GTGGTCCCCTAGAGGGAATAAGG - Intronic
934618737 2:95791378-95791400 GTGCTGACAAATAGGGAAGAGGG + Intergenic
934642156 2:96033179-96033201 GTGCTGACAAATAGGGAAGAGGG - Intronic
935399251 2:102643265-102643287 GTGGTGTCAGAGAAGGAAAAGGG - Intronic
935874936 2:107496210-107496232 GTGATGACATGGAGAGGACAGGG - Intergenic
939192256 2:138930740-138930762 GAGGTGAGAGAGAGTGAACAGGG + Intergenic
939872725 2:147542947-147542969 GTTGGGCCATAGAGAGAACAGGG + Intergenic
940152172 2:150614777-150614799 GCAGTGACATAAAGGGAAGAAGG + Intergenic
941400601 2:165026097-165026119 ATGGTGAAATAGGGGGATCAAGG - Intergenic
943565176 2:189508613-189508635 GTGGTTACAAAAAGGCAACAAGG + Intergenic
945039689 2:205733572-205733594 GGGGAGAGATTGAGGGAACAGGG - Intronic
945057359 2:205880601-205880623 CTGGGGACATAGGGGTAACAGGG + Intergenic
946880785 2:224175496-224175518 GTAGTGGCAAACAGGGAACATGG + Intergenic
947434353 2:230060128-230060150 GTGGTGACATACAGGTCACCAGG + Intronic
948851082 2:240706275-240706297 GAGGTGACACAGAGGACACACGG + Intergenic
948921683 2:241068878-241068900 GAGGTGACAAAGAGAGAACAGGG - Intronic
1172158256 20:32844929-32844951 GTGGGGACAGTGAGGGAAAATGG + Intronic
1172514040 20:35520913-35520935 GTGGTGTCAGAGAGGGACTAGGG - Intergenic
1172892683 20:38278191-38278213 GTGGGGCCATAGAGGGAAAGGGG - Intronic
1172896601 20:38304616-38304638 GAGGTTACATAGAGGGAAGGAGG - Intronic
1173474854 20:43351838-43351860 GTGGGCACATAGTGGGAACATGG - Intergenic
1175316959 20:58055181-58055203 ATGGTGAGAATGAGGGAACAGGG + Intergenic
1175361829 20:58418008-58418030 CTGGTGAAATAGTGGGAACATGG + Intronic
1175482828 20:59323479-59323501 CTGGGGACATAGCAGGAACAAGG + Intronic
1176959469 21:15142971-15142993 GTGGTGAAGTAGAGGAAGCATGG + Intergenic
1177770210 21:25505499-25505521 GTGGTGGCATAGGAGGAAAATGG - Intergenic
1177916587 21:27095946-27095968 GTGGGGACTTAGAGAGAAAAAGG - Intergenic
1178041009 21:28641144-28641166 GTGGTGAAAGTGAGGAAACAAGG - Intergenic
1180488062 22:15819539-15819561 GTGGTGACAGGCAGGGAATATGG + Intergenic
1181386718 22:22551092-22551114 GAGGAAACATACAGGGAACAAGG + Intronic
1182049754 22:27303717-27303739 GAGGTCACATAATGGGAACATGG + Intergenic
1182128307 22:27832590-27832612 GTGGGGACAATGAGGGCACAGGG - Intergenic
1183994247 22:41621030-41621052 GAGGTGACAGAGAGGGGACAGGG + Exonic
1184195637 22:42925873-42925895 CTGGTGACATAGAGGGCCCAGGG - Intronic
949529146 3:4936823-4936845 GTAGTGACATAGAGGGAGCATGG + Intergenic
950335572 3:12190257-12190279 GTGGGGACAGTGTGGGAACAAGG - Intronic
953824538 3:46239556-46239578 GTGGTGAAATAGAAGGCACCTGG - Intronic
954396459 3:50295872-50295894 GTATTGACAAAGACGGAACATGG - Intronic
955164969 3:56501977-56501999 GTGAAGACATAGAGAGAAGATGG - Intergenic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
957608554 3:82436026-82436048 GTGGTAACCAAAAGGGAACAGGG + Intergenic
960039510 3:113135525-113135547 GTGGTACCATAGAAGGAAAATGG + Intergenic
960436110 3:117628798-117628820 GTGGTGAGAGAGAGAGAAGAAGG - Intergenic
961350641 3:126300013-126300035 GTGGTGACATACCGGTAGCATGG + Intergenic
962009603 3:131381061-131381083 GTGGTGAAATTGAGGGGACTTGG - Intergenic
963268623 3:143264363-143264385 GGACTGACATAGAGGGAAGAGGG + Intergenic
964714236 3:159705307-159705329 GTGGTCACATAGAAGGAAGCTGG - Intronic
967646981 3:191937121-191937143 GAGGTCACATAGAGAGAGCAGGG + Intergenic
968752803 4:2398983-2399005 GTGGCGAGATTGAGGGCACAAGG + Intronic
968752836 4:2399133-2399155 GTGGTGAGATCCAGGGCACAAGG + Intronic
968752843 4:2399157-2399179 GGGGTGAGATCGAGGGCACAAGG + Intronic
970330902 4:14982974-14982996 GGGGTGAGATAGAGGGAAATGGG - Intergenic
971102967 4:23488764-23488786 GTGATGACAGTGAGGAAACATGG - Intergenic
972985597 4:44760673-44760695 GCAGTGAAATAGATGGAACAGGG + Intergenic
973034591 4:45390465-45390487 CTGGTGCCCTAGAGGGATCAAGG + Intergenic
973173037 4:47168904-47168926 GTGGAGACACAGGGGGAAGATGG - Intronic
974444220 4:61958621-61958643 GTGGTGAGAGAGAGAGAGCAGGG + Intronic
974488484 4:62534030-62534052 GTGGAGAAATAGAGGCATCAAGG + Intergenic
976741588 4:88362517-88362539 GTGATGACATAGAAAGAAAAGGG - Intergenic
978956904 4:114625099-114625121 ATGATGACCTAGAGAGAACAAGG - Intronic
979193149 4:117888106-117888128 TTGGTAACATACAGGGAAAATGG + Intergenic
979397712 4:120208234-120208256 GTGATGCCTTAGAGGGAGCAGGG - Intergenic
981818900 4:148863401-148863423 GTGGGAACATAGAGGGAAATAGG + Intergenic
983446073 4:167854499-167854521 GTGGTACCATAGAGGAAACCTGG - Intergenic
986178031 5:5368551-5368573 GTGGAGACATTGAGGTAAAAAGG + Intergenic
986314686 5:6578744-6578766 GTGGTGACATGGAGGTGACTCGG - Intergenic
986375281 5:7124760-7124782 GTGGTGCTATAGAGGCAATAGGG + Intergenic
986443719 5:7803099-7803121 GTGGTGACAGAAAGTGCACAGGG - Intronic
989304559 5:39938391-39938413 GTGGTGGCATGGTGGGAAGAGGG - Intergenic
994089255 5:95794500-95794522 CTTGTTACATAGAGGGAAAATGG + Exonic
995673634 5:114636519-114636541 GTGGTGAGAGAGAGAGAAGAGGG + Intergenic
996724995 5:126666777-126666799 GTGGTGAAGGAGAGGAAACAGGG - Intergenic
996966927 5:129317346-129317368 GTGGTGACAGAGATATAACAGGG + Intergenic
998102835 5:139448619-139448641 GAGGTGACAGAGAGAGAGCAAGG - Exonic
999365522 5:151021045-151021067 GAGGTGACATAGATGTAGCAAGG - Intronic
1000484591 5:161824774-161824796 GTGGTGACAGAGAGGAAAATTGG - Intergenic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002810985 6:628470-628492 GTGGGGAGGTAGAGAGAACAGGG + Intronic
1004919413 6:20361951-20361973 GTGGGGAAATAGAGGGGAAATGG + Intergenic
1005181429 6:23111877-23111899 GTGGAGACCTTGAAGGAACAGGG + Intergenic
1007413540 6:41678943-41678965 CTGGTGACAGAGTGGGCACAGGG - Intergenic
1007717989 6:43868376-43868398 CTGGAGACATAGAGGGTACATGG - Intergenic
1007940248 6:45774015-45774037 GTGGTGACATTGGTGGAACTGGG + Intergenic
1008273221 6:49514193-49514215 GTGGTCACTTTTAGGGAACAGGG - Intronic
1008816822 6:55578846-55578868 GAGGTGACATAAAGGGAGGAGGG + Intronic
1010651857 6:78464990-78465012 GTAGGGACACAGAGGGAAAAAGG - Intergenic
1010977583 6:82333214-82333236 GTGGGGAGAGAGAGAGAACAAGG - Intergenic
1011598711 6:89040519-89040541 ATGGTGACACAGAGGTAAGAAGG - Intergenic
1011613610 6:89178053-89178075 GTTGTGTCATAGAGGTAACTAGG - Exonic
1012096571 6:94970087-94970109 GTGGGGACATAGATGGAGCCGGG + Intergenic
1014327428 6:120016812-120016834 GTTGTGGGATAGAGGGAGCAGGG + Intergenic
1014368529 6:120576006-120576028 GTAATGACATAGATGGAAAAGGG - Intergenic
1014594358 6:123314690-123314712 GCAGTGACACAGATGGAACAAGG + Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1015831134 6:137370145-137370167 GTGGTTACAAAGAGGGTAAATGG - Intergenic
1016803938 6:148194124-148194146 TTGGTCACATAAAGGGAAAATGG - Intergenic
1019598934 7:1871856-1871878 GAGGGGACATGGAGGGGACAGGG + Intronic
1021292856 7:18867143-18867165 GTGGAGACATGCAGGGAAGAAGG + Intronic
1022660156 7:32359497-32359519 TTGGAGACATAGAGGCAACAAGG - Intergenic
1024745547 7:52401550-52401572 GTGATAACATAGAGGTTACAAGG + Intergenic
1028406731 7:90483461-90483483 GATTTGTCATAGAGGGAACAAGG - Intronic
1029160046 7:98545046-98545068 GGGGTGACACTGAGGGAGCAAGG - Intergenic
1029251539 7:99240294-99240316 ATGGTGACATAGAAGGGGCATGG - Intergenic
1030839917 7:114336829-114336851 ATGGTGAAATACAGTGAACATGG - Intronic
1031533031 7:122899362-122899384 TTGGTGCTATAGATGGAACAAGG + Intergenic
1033046099 7:137963270-137963292 GTGCTGACTAAGTGGGAACAGGG - Intronic
1033944401 7:146698085-146698107 GTGATGACATAGGGGGAATTGGG - Intronic
1034912806 7:155011412-155011434 TTTGTGACTGAGAGGGAACATGG - Intergenic
1034930999 7:155164073-155164095 GTGTTAACATAGAGGTAACTGGG - Intergenic
1035140225 7:156752304-156752326 GTGGTGACCTGGAGGGGATATGG + Intronic
1035421741 7:158735053-158735075 GTGCTGCCATGGAGGGCACATGG - Intronic
1035973804 8:4284444-4284466 ATGGTGACGGGGAGGGAACACGG - Intronic
1035993985 8:4525170-4525192 GTTGTGGCATAGAGGGAAGGTGG - Intronic
1039892081 8:41692639-41692661 GCAGGGACATAGAGGTAACAGGG - Exonic
1041528506 8:58836176-58836198 AAGGTGACATTAAGGGAACAGGG + Intronic
1042405417 8:68399456-68399478 GCAGTGACATAGATGGAACTGGG - Intronic
1043220729 8:77660180-77660202 GTGGTGACAAAAGGGTAACAGGG + Intergenic
1043238765 8:77903643-77903665 ATAGTGACATAGAGGAAAAAAGG - Intergenic
1043917304 8:85937762-85937784 GTGCTGACATAGAGCCACCATGG + Intergenic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1046889167 8:119402108-119402130 GTGATGACAATGATGGAACATGG - Intergenic
1047610304 8:126514597-126514619 GGTGTCACATAGAGGGACCAAGG + Intergenic
1047761507 8:127958050-127958072 GTGGTGAGGTGAAGGGAACACGG + Intergenic
1048329217 8:133460894-133460916 GTGGGGACAAAGAGGGGACGGGG + Intronic
1048531495 8:135254119-135254141 GTGGGGAGATAGTGGGAACTGGG - Intergenic
1049885076 9:21362-21384 ATGGTGACAGATAGGGAACGAGG - Intergenic
1053591671 9:39520904-39520926 GTGGGGTCATAGAGAGAACAGGG - Intergenic
1054574637 9:66844385-66844407 GCGGGGTCATAGAGAGAACAGGG + Intergenic
1055581518 9:77711363-77711385 GTGCTGACATAGAGGCAGAAAGG - Intergenic
1056821680 9:89846486-89846508 GTGGTGAGGTAGTGGGAAGAAGG + Intergenic
1057956125 9:99409441-99409463 GTGGCTACAAAGAGAGAACATGG - Intergenic
1058503151 9:105642959-105642981 GTAGAGACATAGAGAGAAGATGG + Intergenic
1058770473 9:108226411-108226433 GTGCTGTAATAGAGAGAACATGG - Intergenic
1059527632 9:115007123-115007145 GTGGTTACATAGTGAGAACCAGG - Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060482095 9:124022634-124022656 GAGGTGACACAGAGGGATGACGG + Intronic
1060492255 9:124093504-124093526 GTGGTGACATAGAGGAAGAATGG + Intergenic
1185824545 X:3237271-3237293 GTGGTGACCTAGAAGGACAATGG + Intergenic
1188029914 X:25252801-25252823 GAGGAGACATACAGGGAAGAAGG + Intergenic
1189018807 X:37313118-37313140 GTGGGGACAGAGAGTGAATATGG - Intergenic
1189707234 X:43770995-43771017 GTGTTGACTAAGATGGAACATGG - Intronic
1190819679 X:53961683-53961705 GGGGTGACATAGGGGTAGCAGGG - Intronic
1191995341 X:67089315-67089337 GGTGTGCCATACAGGGAACAGGG - Intergenic
1192709796 X:73567892-73567914 GTGGTGACATACAGAGAGCCAGG - Intronic
1195363573 X:104107127-104107149 GTGGGGATATAGATGGAACAGGG - Intronic
1196768152 X:119268362-119268384 GGGGTGAGATGGAGAGAACAAGG - Intergenic
1198337124 X:135677395-135677417 ATGGTGTCATAAAGGGAAGAAGG - Intergenic