ID: 921785186

View in Genome Browser
Species Human (GRCh38)
Location 1:219221293-219221315
Sequence GGGGAACCTCTATGAATCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921785179_921785186 10 Left 921785179 1:219221260-219221282 CCGAAGCATTGGTGAAGCAGGCC No data
Right 921785186 1:219221293-219221315 GGGGAACCTCTATGAATCAGGGG No data
921785176_921785186 29 Left 921785176 1:219221241-219221263 CCAGCAGATTTCAGCTTAGCCGA No data
Right 921785186 1:219221293-219221315 GGGGAACCTCTATGAATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921785186 Original CRISPR GGGGAACCTCTATGAATCAG GGG Intergenic
No off target data available for this crispr