ID: 921791601

View in Genome Browser
Species Human (GRCh38)
Location 1:219296568-219296590
Sequence CACCCTGAAGACGGGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921791597_921791601 21 Left 921791597 1:219296524-219296546 CCAGGCACATAAGTGGAGGGGAC No data
Right 921791601 1:219296568-219296590 CACCCTGAAGACGGGTAGCTGGG No data
921791592_921791601 28 Left 921791592 1:219296517-219296539 CCATCAACCAGGCACATAAGTGG No data
Right 921791601 1:219296568-219296590 CACCCTGAAGACGGGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921791601 Original CRISPR CACCCTGAAGACGGGTAGCT GGG Intergenic
No off target data available for this crispr