ID: 921800328

View in Genome Browser
Species Human (GRCh38)
Location 1:219395784-219395806
Sequence TGATTTTTACATATGGTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921800325_921800328 -5 Left 921800325 1:219395766-219395788 CCTTGATCCATCTTGAGTTGATT 0: 194
1: 515
2: 568
3: 569
4: 642
Right 921800328 1:219395784-219395806 TGATTTTTACATATGGTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921800328 Original CRISPR TGATTTTTACATATGGTGTA AGG Intergenic
No off target data available for this crispr