ID: 921800328 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:219395784-219395806 |
| Sequence | TGATTTTTACATATGGTGTA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921800325_921800328 | -5 | Left | 921800325 | 1:219395766-219395788 | CCTTGATCCATCTTGAGTTGATT | 0: 194 1: 515 2: 568 3: 569 4: 642 |
||
| Right | 921800328 | 1:219395784-219395806 | TGATTTTTACATATGGTGTAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921800328 | Original CRISPR | TGATTTTTACATATGGTGTA AGG | Intergenic | ||
| No off target data available for this crispr | |||||