ID: 921800636

View in Genome Browser
Species Human (GRCh38)
Location 1:219399067-219399089
Sequence GCACCCTTGTTGGCTGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921800628_921800636 25 Left 921800628 1:219399019-219399041 CCTCATTTGCACATGCCAGCAGC No data
Right 921800636 1:219399067-219399089 GCACCCTTGTTGGCTGCAGCAGG No data
921800627_921800636 29 Left 921800627 1:219399015-219399037 CCGTCCTCATTTGCACATGCCAG No data
Right 921800636 1:219399067-219399089 GCACCCTTGTTGGCTGCAGCAGG No data
921800629_921800636 10 Left 921800629 1:219399034-219399056 CCAGCAGCAGCAGCAGTAGCAGT No data
Right 921800636 1:219399067-219399089 GCACCCTTGTTGGCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921800636 Original CRISPR GCACCCTTGTTGGCTGCAGC AGG Intergenic
No off target data available for this crispr