ID: 921801194

View in Genome Browser
Species Human (GRCh38)
Location 1:219404340-219404362
Sequence CTGGAAAAGGATTACTCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921801194_921801201 28 Left 921801194 1:219404340-219404362 CCAAAAGAGTAATCCTTTTCCAG No data
Right 921801201 1:219404391-219404413 ATTATGTCATTTTGTAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921801194 Original CRISPR CTGGAAAAGGATTACTCTTT TGG (reversed) Intergenic
No off target data available for this crispr