ID: 921802402

View in Genome Browser
Species Human (GRCh38)
Location 1:219416588-219416610
Sequence ATTTGCATACAATTAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921802402_921802405 4 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG No data
921802402_921802408 9 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802408 1:219416620-219416642 GATCAATGCAAATTGAGGGGTGG No data
921802402_921802410 29 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802410 1:219416640-219416662 TGGGTCATTTAGAACTTTGTAGG No data
921802402_921802406 5 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802406 1:219416616-219416638 GGTTGATCAATGCAAATTGAGGG No data
921802402_921802411 30 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802411 1:219416641-219416663 GGGTCATTTAGAACTTTGTAGGG No data
921802402_921802409 10 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802409 1:219416621-219416643 ATCAATGCAAATTGAGGGGTGGG No data
921802402_921802407 6 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802407 1:219416617-219416639 GTTGATCAATGCAAATTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921802402 Original CRISPR ATTTGCATACAATTAAAAGT GGG (reversed) Intergenic
No off target data available for this crispr