ID: 921802403

View in Genome Browser
Species Human (GRCh38)
Location 1:219416589-219416611
Sequence AATTTGCATACAATTAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921802403_921802409 9 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802409 1:219416621-219416643 ATCAATGCAAATTGAGGGGTGGG No data
921802403_921802407 5 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802407 1:219416617-219416639 GTTGATCAATGCAAATTGAGGGG No data
921802403_921802405 3 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG No data
921802403_921802406 4 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802406 1:219416616-219416638 GGTTGATCAATGCAAATTGAGGG No data
921802403_921802411 29 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802411 1:219416641-219416663 GGGTCATTTAGAACTTTGTAGGG No data
921802403_921802408 8 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802408 1:219416620-219416642 GATCAATGCAAATTGAGGGGTGG No data
921802403_921802410 28 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802410 1:219416640-219416662 TGGGTCATTTAGAACTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921802403 Original CRISPR AATTTGCATACAATTAAAAG TGG (reversed) Intergenic