ID: 921802405

View in Genome Browser
Species Human (GRCh38)
Location 1:219416615-219416637
Sequence AGGTTGATCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921802402_921802405 4 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG No data
921802403_921802405 3 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921802405 Original CRISPR AGGTTGATCAATGCAAATTG AGG Intergenic
No off target data available for this crispr