ID: 921802406

View in Genome Browser
Species Human (GRCh38)
Location 1:219416616-219416638
Sequence GGTTGATCAATGCAAATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921802403_921802406 4 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802406 1:219416616-219416638 GGTTGATCAATGCAAATTGAGGG No data
921802402_921802406 5 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802406 1:219416616-219416638 GGTTGATCAATGCAAATTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921802406 Original CRISPR GGTTGATCAATGCAAATTGA GGG Intergenic