ID: 921802406 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:219416616-219416638 |
Sequence | GGTTGATCAATGCAAATTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
921802402_921802406 | 5 | Left | 921802402 | 1:219416588-219416610 | CCCACTTTTAATTGTATGCAAAT | No data | ||
Right | 921802406 | 1:219416616-219416638 | GGTTGATCAATGCAAATTGAGGG | No data | ||||
921802403_921802406 | 4 | Left | 921802403 | 1:219416589-219416611 | CCACTTTTAATTGTATGCAAATT | No data | ||
Right | 921802406 | 1:219416616-219416638 | GGTTGATCAATGCAAATTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
921802406 | Original CRISPR | GGTTGATCAATGCAAATTGA GGG | Intergenic | ||