ID: 921802408

View in Genome Browser
Species Human (GRCh38)
Location 1:219416620-219416642
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921802402_921802408 9 Left 921802402 1:219416588-219416610 CCCACTTTTAATTGTATGCAAAT No data
Right 921802408 1:219416620-219416642 GATCAATGCAAATTGAGGGGTGG No data
921802403_921802408 8 Left 921802403 1:219416589-219416611 CCACTTTTAATTGTATGCAAATT No data
Right 921802408 1:219416620-219416642 GATCAATGCAAATTGAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr