ID: 921802827

View in Genome Browser
Species Human (GRCh38)
Location 1:219420615-219420637
Sequence CAAATTATAAAACAAGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921802827_921802829 1 Left 921802827 1:219420615-219420637 CCAGTGACTTGTTTTATAATTTG No data
Right 921802829 1:219420639-219420661 TAATGCTGCCATTGTATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921802827 Original CRISPR CAAATTATAAAACAAGTCAC TGG (reversed) Intergenic
No off target data available for this crispr