ID: 921802829

View in Genome Browser
Species Human (GRCh38)
Location 1:219420639-219420661
Sequence TAATGCTGCCATTGTATGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921802826_921802829 18 Left 921802826 1:219420598-219420620 CCTAATTTTTTTTTTCTCCAGTG No data
Right 921802829 1:219420639-219420661 TAATGCTGCCATTGTATGAGTGG No data
921802827_921802829 1 Left 921802827 1:219420615-219420637 CCAGTGACTTGTTTTATAATTTG No data
Right 921802829 1:219420639-219420661 TAATGCTGCCATTGTATGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921802829 Original CRISPR TAATGCTGCCATTGTATGAG TGG Intergenic
No off target data available for this crispr