ID: 921802929

View in Genome Browser
Species Human (GRCh38)
Location 1:219422081-219422103
Sequence ATGGAAACCTTGGGAAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921802929_921802935 11 Left 921802929 1:219422081-219422103 CCATTTTTTCCCAAGGTTTCCAT No data
Right 921802935 1:219422115-219422137 TTATTAGTACCATGGTGAACAGG No data
921802929_921802934 3 Left 921802929 1:219422081-219422103 CCATTTTTTCCCAAGGTTTCCAT No data
Right 921802934 1:219422107-219422129 GAAAATAGTTATTAGTACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921802929 Original CRISPR ATGGAAACCTTGGGAAAAAA TGG (reversed) Intergenic
No off target data available for this crispr