ID: 921805407

View in Genome Browser
Species Human (GRCh38)
Location 1:219448568-219448590
Sequence AGGTGTAGACAGATGGACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921805407_921805410 -6 Left 921805407 1:219448568-219448590 CCATTGTCCATCTGTCTACACCT No data
Right 921805410 1:219448585-219448607 ACACCTGCAGTGTGGTCTTCTGG No data
921805407_921805412 5 Left 921805407 1:219448568-219448590 CCATTGTCCATCTGTCTACACCT No data
Right 921805412 1:219448596-219448618 GTGGTCTTCTGGTAAGAGCATGG No data
921805407_921805413 25 Left 921805407 1:219448568-219448590 CCATTGTCCATCTGTCTACACCT No data
Right 921805413 1:219448616-219448638 TGGTACTTAGTCAAAAGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921805407 Original CRISPR AGGTGTAGACAGATGGACAA TGG (reversed) Intergenic
No off target data available for this crispr