ID: 921808889

View in Genome Browser
Species Human (GRCh38)
Location 1:219489111-219489133
Sequence ACCTGGGCCCCTGAAAGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921808889_921808897 24 Left 921808889 1:219489111-219489133 CCAGTACTTTCAGGGGCCCAGGT No data
Right 921808897 1:219489158-219489180 CGAGACCAGCCTGACCAACATGG 0: 17242
1: 79982
2: 161919
3: 193058
4: 126290
921808889_921808893 -8 Left 921808889 1:219489111-219489133 CCAGTACTTTCAGGGGCCCAGGT No data
Right 921808893 1:219489126-219489148 GCCCAGGTGGGTGGATCAAGAGG No data
921808889_921808896 -3 Left 921808889 1:219489111-219489133 CCAGTACTTTCAGGGGCCCAGGT No data
Right 921808896 1:219489131-219489153 GGTGGGTGGATCAAGAGGTCAGG 0: 78
1: 8946
2: 34548
3: 61587
4: 56221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921808889 Original CRISPR ACCTGGGCCCCTGAAAGTAC TGG (reversed) Intergenic
No off target data available for this crispr