ID: 921811025

View in Genome Browser
Species Human (GRCh38)
Location 1:219514619-219514641
Sequence CAGGGTACACATTTTGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921811021_921811025 -4 Left 921811021 1:219514600-219514622 CCAATAGTCTCCGTGAGTGCAGG No data
Right 921811025 1:219514619-219514641 CAGGGTACACATTTTGTTGCAGG No data
921811020_921811025 -3 Left 921811020 1:219514599-219514621 CCCAATAGTCTCCGTGAGTGCAG No data
Right 921811025 1:219514619-219514641 CAGGGTACACATTTTGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921811025 Original CRISPR CAGGGTACACATTTTGTTGC AGG Intergenic
No off target data available for this crispr