ID: 921815678

View in Genome Browser
Species Human (GRCh38)
Location 1:219560709-219560731
Sequence CTGGCTAATTTCTCTTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921815678_921815680 29 Left 921815678 1:219560709-219560731 CCATAACAAGAGAAATTAGCCAG No data
Right 921815680 1:219560761-219560783 ATTTCACTAAAATCAGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921815678 Original CRISPR CTGGCTAATTTCTCTTGTTA TGG (reversed) Intergenic
No off target data available for this crispr