ID: 921824173

View in Genome Browser
Species Human (GRCh38)
Location 1:219653248-219653270
Sequence CCTATGTATGGCTTTCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921824173_921824176 -1 Left 921824173 1:219653248-219653270 CCAGAGAGAAAGCCATACATAGG No data
Right 921824176 1:219653270-219653292 GTAACCCACACCAACTGTAAAGG No data
921824173_921824179 5 Left 921824173 1:219653248-219653270 CCAGAGAGAAAGCCATACATAGG No data
Right 921824179 1:219653276-219653298 CACACCAACTGTAAAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921824173 Original CRISPR CCTATGTATGGCTTTCTCTC TGG (reversed) Intergenic
No off target data available for this crispr