ID: 921825071

View in Genome Browser
Species Human (GRCh38)
Location 1:219663346-219663368
Sequence CTTTTTAAAGGGGTGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921825071_921825078 -9 Left 921825071 1:219663346-219663368 CCAGCCACCACCCCTTTAAAAAG No data
Right 921825078 1:219663360-219663382 TTTAAAAAGACCTCCAACCCGGG 0: 1
1: 0
2: 2
3: 14
4: 214
921825071_921825077 -10 Left 921825071 1:219663346-219663368 CCAGCCACCACCCCTTTAAAAAG No data
Right 921825077 1:219663359-219663381 CTTTAAAAAGACCTCCAACCCGG 0: 1
1: 0
2: 0
3: 9
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921825071 Original CRISPR CTTTTTAAAGGGGTGGTGGC TGG (reversed) Intergenic
No off target data available for this crispr