ID: 921825936

View in Genome Browser
Species Human (GRCh38)
Location 1:219671953-219671975
Sequence CAGTTTGCATAGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921825936_921825940 6 Left 921825936 1:219671953-219671975 CCTGCTTCCCTCTATGCAAACTG No data
Right 921825940 1:219671982-219672004 ACCTCTTAACTCTCCAAAAAGGG No data
921825936_921825944 23 Left 921825936 1:219671953-219671975 CCTGCTTCCCTCTATGCAAACTG No data
Right 921825944 1:219671999-219672021 AAAGGGTGGTTAAGATCCACAGG No data
921825936_921825942 9 Left 921825936 1:219671953-219671975 CCTGCTTCCCTCTATGCAAACTG No data
Right 921825942 1:219671985-219672007 TCTTAACTCTCCAAAAAGGGTGG No data
921825936_921825939 5 Left 921825936 1:219671953-219671975 CCTGCTTCCCTCTATGCAAACTG No data
Right 921825939 1:219671981-219672003 CACCTCTTAACTCTCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921825936 Original CRISPR CAGTTTGCATAGAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr