ID: 921827489

View in Genome Browser
Species Human (GRCh38)
Location 1:219689800-219689822
Sequence AAGTGTTCAAAAATGCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921827489_921827490 5 Left 921827489 1:219689800-219689822 CCTACAAGCATTTTTGAACACTT 0: 1
1: 0
2: 5
3: 26
4: 260
Right 921827490 1:219689828-219689850 GTACCAGACATTAAACTAGATGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921827489 Original CRISPR AAGTGTTCAAAAATGCTTGT AGG (reversed) Intronic
900733845 1:4282175-4282197 AAGTGTGCATAAATATTTGTTGG + Intergenic
901339795 1:8486096-8486118 AAGTCTTCAATAGTGATTGTAGG - Intronic
904926019 1:34048866-34048888 AACTGGACAGAAATGCTTGTTGG + Intronic
905046865 1:35011128-35011150 AAATTTTAAAAAATGTTTGTGGG - Intronic
905725560 1:40248495-40248517 AAGTGATCAAAAATTTTTGAGGG - Intronic
907051536 1:51332743-51332765 AAGGGTAAAAAAATGCTTATTGG + Intronic
907129201 1:52080485-52080507 AAGATTTCTAAAATGCTTCTGGG - Intronic
907836736 1:58116269-58116291 AATTGTTCAAAGATGCTTCCAGG - Intronic
908615821 1:65921267-65921289 AGATGTTCAGAAATGCTTTTAGG - Intronic
909647731 1:77936285-77936307 AAATGTTCAAAAATATTTTTTGG + Intronic
909873518 1:80775929-80775951 AAATGTTCAAAGATGCTCATTGG - Intergenic
910466382 1:87504757-87504779 AGGTGCTCAAAAATATTTGTTGG + Intergenic
910950622 1:92643572-92643594 TAGTTTTCAAAAATGATTGAAGG - Intronic
911469562 1:98300789-98300811 AAGTGGTAAAAATTGCTAGTTGG - Intergenic
913708344 1:121451613-121451635 AAGTGATCAAAAATGTTTGTTGG - Intergenic
914452761 1:147807298-147807320 AAGTGTCAGAAAATGCTTGTTGG + Intergenic
916145616 1:161736344-161736366 AAGTCTACAAAAATGCTCATGGG + Intergenic
920158804 1:203979408-203979430 AGTTGGTCAAAAATGCTTCTTGG + Intergenic
921335418 1:214080780-214080802 AACTTTTAAAATATGCTTGTTGG + Intergenic
921827489 1:219689800-219689822 AAGTGTTCAAAAATGCTTGTAGG - Intronic
921871921 1:220150385-220150407 AAGTGTTTAGAAATGCTTCTGGG - Exonic
922136164 1:222829089-222829111 GAGTTTTCAAAAGTGCTTTTTGG - Intergenic
922641715 1:227238871-227238893 AAGTTTTCAAATATAATTGTGGG - Intronic
922991670 1:229918705-229918727 AAGTGTTTAAAAATGGTAGTGGG + Intergenic
924047252 1:240044314-240044336 AATTGTTCAAAAATGTATGTGGG - Intronic
924378471 1:243438192-243438214 AAGTGTTCAATAATGAGTGCAGG + Intronic
1063715581 10:8523194-8523216 AAGTGTTCAAAATACCTAGTGGG + Intergenic
1064439709 10:15342844-15342866 AAATGATCAAAAATCCATGTAGG - Intronic
1064525706 10:16254303-16254325 GAGTGTTCTCATATGCTTGTTGG - Intergenic
1064889793 10:20157844-20157866 AAGTATTCATGAATGCTTTTAGG + Intronic
1066708565 10:38207056-38207078 AAGTCTTTAAAAATGTTTTTGGG - Intergenic
1066795470 10:39115244-39115266 AAGTGCTCAAAAAGGCCTATGGG + Intergenic
1066980937 10:42415530-42415552 AAGTCTTTAAAAATGTTTTTGGG + Intergenic
1067384713 10:45808199-45808221 GAATGTTCAAAAATGCCTTTGGG + Intergenic
1068419683 10:56773835-56773857 AAGAGTTCAACAATAATTGTTGG + Intergenic
1068751000 10:60592213-60592235 AATTATTAAAAAAAGCTTGTGGG - Intronic
1071472801 10:85996313-85996335 GAGTGTTCACAATTGCTTGTTGG - Intronic
1071794501 10:88990672-88990694 AGGTGTTCAAAGACGCTTCTGGG + Exonic
1072446845 10:95506437-95506459 AGGTTTTAAAAAATACTTGTTGG - Intronic
1073008786 10:100344297-100344319 AAGTTTTAAAAAATGATTTTTGG + Intergenic
1073918006 10:108428410-108428432 AACTTTCAAAAAATGCTTGTTGG + Intergenic
1074787524 10:116854156-116854178 ATGTGTTCAAGGAGGCTTGTTGG - Intronic
1075794520 10:125109623-125109645 AAGTGTTCAAAGATGACTGAGGG + Intronic
1077854516 11:6109345-6109367 AAGTGTTAAATACTTCTTGTAGG + Intergenic
1078942284 11:16020879-16020901 TAGTGTTCATAAATACTTGCAGG + Intronic
1079179043 11:18172378-18172400 CTGTGTACAAAAATGCTTCTAGG + Intronic
1079269808 11:18973562-18973584 CTGTGTACAAAAATGCTTCTAGG - Intergenic
1080951675 11:37040966-37040988 AAGTGTTTTAAGATGCTTTTAGG + Intergenic
1081232582 11:40604172-40604194 ATGTTTTCAAAAATTCCTGTTGG - Intronic
1081299841 11:41437531-41437553 GAGTGTACAAAAAAGCTTGAAGG - Intronic
1083045233 11:59728620-59728642 AAGTGTCCAACAAGGCTTCTTGG - Intronic
1083170169 11:60919428-60919450 AAGTGTTGAATAATACTTGCTGG + Intronic
1086439255 11:86812152-86812174 AAGTGACCAAACATGCTTGTTGG - Intronic
1086581640 11:88406726-88406748 AACTGTTCTCAAAGGCTTGTAGG - Intergenic
1087592385 11:100207644-100207666 CAGGTTTCAAAAATGCTTTTAGG - Intronic
1091984153 12:4894231-4894253 ATGTGTTCAAGAAGGCTTTTGGG - Intergenic
1092268124 12:6999318-6999340 AAGTGATCAAAAATGTCTGAGGG + Intronic
1093120526 12:15266063-15266085 AAGTGTTCAGCAATGCTTATTGG - Intronic
1093551150 12:20413286-20413308 AAGTCTTCACACATGCTTTTTGG - Intronic
1094006164 12:25754188-25754210 AAGTGTTGAACAATACTTTTTGG + Intergenic
1094336592 12:29363464-29363486 AAGTGTTTAACCATGCTTTTAGG - Intronic
1095541655 12:43316059-43316081 AAGATTTGAAAAATGCATGTGGG + Intergenic
1097721635 12:63028250-63028272 ATGTTTTGAGAAATGCTTGTTGG + Intergenic
1098858136 12:75677378-75677400 AAGTGTTCCCACATGCTTCTAGG + Intergenic
1101741566 12:107503847-107503869 AAATGTCCAAAAAGGCTTCTTGG + Intronic
1101765317 12:107692935-107692957 AAGTGTTCAAAAAACCTTACTGG + Intronic
1106513655 13:30433738-30433760 ACGTGTTCAATAAAGTTTGTTGG - Intergenic
1106882333 13:34145053-34145075 AAGTATTCAAAAATATTTTTTGG - Intergenic
1107709767 13:43140168-43140190 AAGTGTTAAAATATGCTGGGAGG + Intergenic
1109562005 13:64062032-64062054 ATGTGTTGAATACTGCTTGTAGG + Intergenic
1111344950 13:86939496-86939518 AGGTTTTCAAAAATGTTTCTGGG + Intergenic
1111755439 13:92388896-92388918 CTGTGTTCAAAAATGGTTATGGG + Intronic
1111865677 13:93765096-93765118 AATTGTTTAAAAAATCTTGTGGG - Intronic
1112525179 13:100139636-100139658 GAGTGTTCATAATTGCTTGTTGG + Intronic
1113168439 13:107470587-107470609 ACATGTACAAAAATGTTTGTTGG + Intronic
1113323553 13:109262408-109262430 CTGTATTCAAAAATACTTGTAGG - Intergenic
1113420496 13:110167600-110167622 AAGTTTTCAGAAAAGCTCGTTGG - Intronic
1114909532 14:27172790-27172812 AAATTTTAAAAAATGTTTGTGGG + Intergenic
1116663508 14:47744295-47744317 AAATGTTTAAGAATGCCTGTTGG + Intergenic
1117012306 14:51483393-51483415 ATGTGTTCAAAAATGAATGGGGG + Intergenic
1117906476 14:60594040-60594062 AAGTCCTAAAAAATGCTTTTGGG - Intergenic
1118675374 14:68178995-68179017 AAGTGTTATAAAATGATTGTGGG + Intronic
1119950135 14:78736632-78736654 AAGTGTAAATAAATGATTGTGGG - Intronic
1122347742 14:101071046-101071068 AAGTGCTCAGTGATGCTTGTTGG + Intergenic
1124864637 15:33477280-33477302 AAGTGTTCAAAAACTATTCTTGG + Intronic
1126497459 15:49307801-49307823 AAATATTCACAAATGCTTCTTGG + Intronic
1129912741 15:79241817-79241839 AAGTTTTCAAAAATGGTAGCAGG - Intergenic
1132018043 15:98336514-98336536 AATTCTACAAAAAGGCTTGTTGG + Intergenic
1134291910 16:12908387-12908409 TGGTGTTGAAAAATCCTTGTTGG + Intronic
1137816769 16:51405432-51405454 AACTGTCTAAAAATGCTTGGTGG - Intergenic
1140279899 16:73544660-73544682 AAGAGACCAAAGATGCTTGTGGG + Intergenic
1140527450 16:75635016-75635038 ATGTGTATAAAGATGCTTGTTGG + Intronic
1140727218 16:77824453-77824475 AAGTATTAAAAAATGATTGTGGG + Intronic
1143138360 17:4725288-4725310 ATGAGTTCAAAAAAGTTTGTTGG - Intergenic
1145211882 17:21019748-21019770 AAGTATTCAGAAATGTTGGTTGG - Intronic
1149397565 17:56260542-56260564 AACTCATCAAAAATGCTGGTTGG - Intronic
1149474944 17:56952975-56952997 GAGTACTCAAAAATGCCTGTTGG + Intronic
1149761399 17:59233719-59233741 AAGTGTAAGAAAATGCTTATCGG + Intronic
1151867078 17:76810893-76810915 AAGTGTTAATTAATGCTTGCAGG - Intergenic
1153458065 18:5300328-5300350 GAGTGTTCATAATTGCTTGTTGG + Intergenic
1154060800 18:11057819-11057841 TTGTTTTTAAAAATGCTTGTAGG - Intronic
1154063988 18:11089572-11089594 CAGTGTTCAGAAATGCCGGTTGG - Intronic
1154979562 18:21491407-21491429 TAGTGTTCAAAAATTGTTCTGGG + Intronic
1155690139 18:28610680-28610702 ATGTGTTTTAAATTGCTTGTTGG + Intergenic
1156686379 18:39652344-39652366 ACGTGAATAAAAATGCTTGTTGG + Intergenic
1159429549 18:68333725-68333747 AAATATTCAAAACTTCTTGTTGG - Intergenic
1159469105 18:68826298-68826320 AAGATTTCACAAATGGTTGTGGG + Intronic
1160052738 18:75451163-75451185 AATTTTTAAAAAATGCTTGTTGG - Intergenic
1160404310 18:78634639-78634661 AGGAGTTCATAAATGCTTGTTGG + Intergenic
1161540058 19:4845123-4845145 AAGGCTTAAAAAGTGCTTGTAGG + Intronic
1161748625 19:6077459-6077481 AAGTCTTGAGAAATGCTTGGAGG - Intronic
1163219657 19:15907957-15907979 ACATGTTCAAATACGCTTGTTGG + Intergenic
1163329063 19:16624745-16624767 AAGTGGTCACAAAGGCTTCTTGG + Intronic
1164773928 19:30835836-30835858 AAGTTTTAAAAAATGCTTTCAGG + Intergenic
1165655543 19:37529157-37529179 AATTTTTAAAAAATGTTTGTGGG + Intronic
925559638 2:5176474-5176496 AAGTTTTGCAAAATGCTTGATGG - Intergenic
927280652 2:21302880-21302902 AAGTATTCAAAAATATTTATTGG - Intergenic
927315381 2:21675405-21675427 AAGTCTTCAAAAATCAGTGTAGG - Intergenic
927405711 2:22763953-22763975 AGGTGTTCAATAATATTTGTGGG - Intergenic
927427133 2:22994171-22994193 AAATATTCAAAAATGATTGAGGG + Intergenic
928774647 2:34745739-34745761 AAGTGTTCAAAAACCTTTGGTGG + Intergenic
929630608 2:43457709-43457731 AAGTGTTAGAAAATATTTGTGGG - Intronic
930461728 2:51688292-51688314 AAATCTTCAAAAATTATTGTAGG - Intergenic
931841922 2:66160323-66160345 AGCTGTTTAAAAATTCTTGTTGG - Intergenic
932096510 2:68854840-68854862 AAGTTTTGAAGAATACTTGTAGG - Intergenic
932665340 2:73693698-73693720 AATTGTGAAAAAATACTTGTGGG + Intergenic
933882139 2:86680310-86680332 AACTGTTCAAGCATGGTTGTGGG + Intronic
935143851 2:100380205-100380227 ATGGCTTTAAAAATGCTTGTGGG - Intergenic
937950309 2:127381535-127381557 CAGTGTTAATAAATGTTTGTTGG - Intronic
939402816 2:141716163-141716185 AAGTGTTAAAAAGTGCTAGTTGG - Intronic
939764131 2:146224736-146224758 AACAGTTCAAAAATTCTTATTGG - Intergenic
941160799 2:162031942-162031964 AAGTTTTTAAAAATGTTTCTGGG - Intronic
941700968 2:168604319-168604341 GTGTGTTCAAAAATATTTGTAGG + Intronic
941759847 2:169229923-169229945 AAGTTTTCTAAACTTCTTGTTGG + Intronic
941794154 2:169581715-169581737 AAGGATTTAAAAATGCTTTTTGG - Intergenic
942330198 2:174815617-174815639 GAGTGTTCATAATTGCTTGTTGG + Intronic
942800057 2:179864128-179864150 AAGTGATCCAAAATGTCTGTAGG - Intergenic
942983046 2:182105567-182105589 AAGTCTTCAAGAATGATTTTAGG + Intronic
945136965 2:206639745-206639767 AAGTGACCAAAAATCCATGTTGG - Intergenic
945476383 2:210286772-210286794 AAGTAATCAATAATGCTTGGTGG - Intergenic
945774314 2:214085463-214085485 TAGTGATCAAAATTGCTTTTAGG + Intronic
946068744 2:217012745-217012767 AAGTGTTCAGAAATACTGATGGG - Intergenic
948516487 2:238507014-238507036 AAGTTTTCAAAAATGTAGGTAGG - Intergenic
1168796918 20:616666-616688 AAGTGGAAAAAAATGCTTTTGGG - Intergenic
1169021139 20:2332020-2332042 AAGTGTTCCAAAAGGCTTTGGGG + Exonic
1169106817 20:3003441-3003463 AACTTTTCAAAAATACTTTTTGG - Intronic
1170952075 20:20946148-20946170 GAGAGTTCAAAAATCCCTGTCGG + Intergenic
1171069391 20:22052511-22052533 TAGTGTTCACAATTGCTTCTTGG - Intergenic
1172204605 20:33154002-33154024 AAGTGTACATAAATGGTGGTTGG + Intergenic
1174095248 20:48083681-48083703 TAGTGTTCATAATTGCTTATTGG - Intergenic
1174700409 20:52602672-52602694 AAGTGTTCAAAAGTGCTCAGGGG + Intergenic
1174840924 20:53900751-53900773 AAGTGCTCAAAACTGATTGTAGG + Intergenic
1174962687 20:55176077-55176099 AAGTGTTCAAAATTATTTGAAGG + Intergenic
1177663550 21:24121251-24121273 AAATGGTCAAAAATGCATTTTGG - Intergenic
1178745314 21:35244145-35244167 AACTGTTGATAGATGCTTGTGGG + Intronic
1178906494 21:36641395-36641417 AAATGTTCAAAAACATTTGTTGG + Intergenic
1181879620 22:25967971-25967993 AAATGTTCAAAACTGACTGTGGG - Intronic
1182870234 22:33639997-33640019 GAGTTTTCAGAAATGCTTTTCGG + Intronic
1183231609 22:36585701-36585723 AGGTGTTCAAAAAATATTGTTGG + Intronic
1183892642 22:40942764-40942786 AAGGGATCAAAAATACTTGGGGG - Intergenic
949187746 3:1214274-1214296 AATTGTTCAAATGTGTTTGTTGG + Intronic
951110600 3:18799213-18799235 AAGTGATCAAAAATACTTTGGGG - Intergenic
951272864 3:20648934-20648956 AAGTGTTCCAGATTGCTTATTGG + Intergenic
951926552 3:27914414-27914436 AAGTGATCAAGAAAGCTTGCTGG + Intergenic
952527241 3:34223531-34223553 AATTCTACAAAAATGTTTGTGGG - Intergenic
953211962 3:40884173-40884195 AAGTGGTCAAAGATGCTTAAGGG - Intergenic
954478877 3:50778629-50778651 CAGTGTTTAAAAATGCTAATTGG + Intronic
954565191 3:51594010-51594032 AAGTGTGTCAAAATGCTTATGGG - Intronic
955879577 3:63529459-63529481 GAGTGTACTAAAATGTTTGTTGG + Intronic
958896119 3:99831686-99831708 TAGTGTTCAAAAATCTATGTTGG + Intronic
959111960 3:102133176-102133198 AAGTTTTCTTATATGCTTGTAGG - Intronic
959195996 3:103182784-103182806 CAGTGTTCATATATGCCTGTTGG + Intergenic
959541928 3:107549968-107549990 AATTTTTCAAAAATTCTTATGGG + Intronic
959733758 3:109633742-109633764 AAGTGTTGAAAAATAACTGTTGG - Intergenic
960112233 3:113856278-113856300 ATTTCTTCAAAAATGCATGTGGG - Intronic
960367014 3:116785172-116785194 AAATGTTTAAAAATGCTCTTGGG + Intronic
960765351 3:121122741-121122763 AAGTATTCAAAGATGCTTGTAGG + Intronic
964166680 3:153715343-153715365 AAGTGTTTGAAAAAACTTGTGGG + Intergenic
964764263 3:160163396-160163418 AGCTGTTCAAATATGGTTGTTGG - Intergenic
965799737 3:172479414-172479436 AAGTTTTTAAAAATGTTGGTTGG + Intergenic
966288367 3:178324748-178324770 AAATGTTCAAACATGTTTATTGG + Intergenic
966460606 3:180171911-180171933 AAGATTTCAAAAATGCTGATTGG - Intergenic
970270204 4:14338430-14338452 ATGTATTCATGAATGCTTGTTGG + Intergenic
971279235 4:25227821-25227843 AAGTCTTTTAAAATGCTTTTTGG + Intronic
971798938 4:31263237-31263259 AAGTGTTCAACTCTGCTTCTTGG + Intergenic
972401709 4:38710492-38710514 GAGTGTTCATAATTGCTTTTAGG - Intergenic
973011969 4:45087412-45087434 AAGTGTTCAAAAATAACTGCTGG + Intergenic
973726052 4:53777078-53777100 GAGTGTTCAGAAATGCTTCAAGG - Intronic
975222151 4:71825072-71825094 AACAATGCAAAAATGCTTGTTGG - Intergenic
975636862 4:76458918-76458940 AACTGTTCAAAACTGGTTTTAGG + Intronic
976149997 4:82082013-82082035 AAGTCTTCAGAACTGCTTGTGGG - Intergenic
977454305 4:97238193-97238215 AAGTGCTCAATAGTGATTGTTGG - Intronic
978495310 4:109353294-109353316 AAGTGTTTAAAAAAATTTGTTGG + Intergenic
978839992 4:113200718-113200740 AAGTGTTCATCAATGGTTGACGG - Intronic
979147697 4:117265735-117265757 AAGTGATGATAAATGCTTCTTGG - Intergenic
980097635 4:128509293-128509315 AAGTTTTTGAAAATGCTTTTAGG - Intergenic
980196971 4:129601836-129601858 TAGGGTTCAAAAATGACTGTGGG + Intergenic
980723959 4:136733873-136733895 GAGTATTCAAAAAAACTTGTGGG + Intergenic
982019932 4:151192699-151192721 CAGCGTTCACAAAGGCTTGTAGG - Intronic
983815497 4:172121498-172121520 AATTGATCATCAATGCTTGTGGG - Intronic
984169196 4:176341263-176341285 AAGTGTACAATTATTCTTGTGGG - Intergenic
985851679 5:2393051-2393073 AAGTGGTCAAAGATACTAGTGGG + Intergenic
986633711 5:9799933-9799955 ATATATTCAAAAATGCTTGTGGG - Intergenic
987522744 5:19007986-19008008 AGGTGTTCAAAAATGCTCATTGG + Intergenic
988071718 5:26298448-26298470 AAGTGTTCATTAATGCGAGTTGG - Intergenic
988829468 5:34973336-34973358 AGTTGTTCACAAATGCTTATGGG - Intergenic
989673175 5:43943755-43943777 AAGCATTAAAAAATACTTGTTGG + Intergenic
989969753 5:50508941-50508963 AAGTGATCAAAAATGTTTGTTGG + Intergenic
990150729 5:52814434-52814456 AAGTGTTAAAAACTCATTGTGGG - Intronic
990483494 5:56234951-56234973 AAGTTTCCAAAAATGTTTGAGGG - Intergenic
990923189 5:60991176-60991198 ATGTTTTTAAAAATGTTTGTGGG + Intronic
992104778 5:73440911-73440933 AGGTCTCCTAAAATGCTTGTGGG - Intergenic
992917506 5:81473453-81473475 CTGTGTTCATAAATTCTTGTTGG + Intronic
992917763 5:81477039-81477061 AAATGCTCAAAAATGGATGTGGG - Intronic
992974805 5:82103751-82103773 AAGTGTTTTAAAAAGCTTGGTGG + Intronic
993042920 5:82835752-82835774 AAATTTTCAGAAATGCTTTTGGG + Intergenic
993499692 5:88651438-88651460 AATTGTTAAAAGATGATTGTGGG - Intergenic
993880316 5:93353254-93353276 AAGTGATCACGAATGTTTGTTGG - Intergenic
994973235 5:106770658-106770680 AAAAATTCAAAAGTGCTTGTGGG - Intergenic
995313331 5:110738756-110738778 AGGAGTTCAAAGATGCTTCTTGG - Intronic
996596596 5:125210208-125210230 AACTGTTCAAAGAAGCCTGTAGG + Intergenic
997780856 5:136656837-136656859 AAGTGTTCAAATCTGACTGTTGG + Intergenic
998222329 5:140295333-140295355 AAATGTTTATAATTGCTTGTGGG - Intronic
1000023292 5:157337526-157337548 AAGTGTGCAGAAATGGTTGAAGG - Intronic
1001676341 5:173520056-173520078 AACTGTTCAAATATGCAAGTTGG - Intergenic
1002883443 6:1273091-1273113 ATGTGCTCAAAACTGCCTGTGGG + Intergenic
1003966838 6:11260186-11260208 AAGGGTTCAAAAATATATGTTGG + Intronic
1007619672 6:43204257-43204279 AATTGTACAAAAAGGCTTGAGGG - Intronic
1007910188 6:45505683-45505705 GGGTGCTCAAAAATGCTAGTTGG - Intronic
1008033399 6:46721346-46721368 AAATGTTCAAAAATGAATGCAGG - Intronic
1008450558 6:51645879-51645901 CAGTTTTCAAAAATCCTTGCAGG - Intronic
1011837078 6:91445552-91445574 AAGTATTTAAAAAGTCTTGTGGG - Intergenic
1012604480 6:101141086-101141108 AAGTGATCAAAAATGCATGTTGG + Intergenic
1016653737 6:146493818-146493840 ATGTGTTTGAAGATGCTTGTTGG - Intergenic
1016667755 6:146662526-146662548 GAGTGTTCATAATTGCTTGTTGG + Intronic
1017345691 6:153377860-153377882 AAATGTTCAAAAGTGATTTTAGG - Intergenic
1017514440 6:155143175-155143197 AAGTGGTCAAAAAAGTTTATTGG + Intronic
1018286678 6:162247839-162247861 AAGTGTTCAAAAATAATTGTTGG - Intronic
1020431594 7:8121296-8121318 AAATGTTCAAAAGTACTTGCTGG - Intronic
1020900296 7:13995176-13995198 AAGTGTTGAAAACTGGTTATTGG - Intergenic
1022250078 7:28598469-28598491 AAGTGTCCAAAGATGCTTGATGG - Intronic
1022829375 7:34049674-34049696 AAGTGGTCTTAAATCCTTGTTGG - Intronic
1024130684 7:46349741-46349763 AAGTGTTCTAAAATTCTATTAGG + Intergenic
1026064892 7:67062107-67062129 ATGTGTTCAAGAGTACTTGTTGG + Intronic
1026713414 7:72764580-72764602 ATGTGTTCAAGAGTACTTGTTGG - Intronic
1028438555 7:90832261-90832283 AAGTGTTCAGAAACACTTGTAGG + Intronic
1030773929 7:113510232-113510254 AAGCTTTCAAAAATCCCTGTAGG - Intergenic
1031385490 7:121145340-121145362 AAGTATTAGAAAATTCTTGTGGG + Intronic
1031472100 7:122178009-122178031 AACTCTTCAAAATTGCTAGTAGG - Intergenic
1031791396 7:126109381-126109403 AAGTGTTCATCAATGATTATTGG - Intergenic
1032762934 7:134961583-134961605 AAATGTTCACAAATCCTTCTTGG + Intronic
1033916748 7:146335725-146335747 AAGTGTTCATATATACTTTTAGG + Intronic
1034893149 7:154858140-154858162 AAGTGCTGATAAATGCTGGTTGG - Intronic
1035040373 7:155922314-155922336 GTGTGTCCAAAAATGCCTGTGGG + Intergenic
1037783045 8:21884280-21884302 AAGTGTTCAACAATGGATGAAGG + Intergenic
1041159617 8:55026173-55026195 TTGTGTCCAAAAATGCTTGAAGG + Intergenic
1041256198 8:55981374-55981396 AGATGCTCAAAAATGCTTGTTGG + Intronic
1041641470 8:60207271-60207293 AAGTGTGCATAAAATCTTGTGGG - Intronic
1042150267 8:65775063-65775085 AAGTGTTCAAATATATTTTTGGG + Intronic
1043676723 8:82966043-82966065 AACTGTTGAAAAATTCTAGTGGG - Intergenic
1048953239 8:139513317-139513339 AAGTATTCACAATTGCTTGTTGG + Intergenic
1049912223 9:280287-280309 AAGTATTGAAAATTGCTTGAGGG + Intronic
1050260172 9:3833195-3833217 GAGTGATAAAACATGCTTGTGGG - Intronic
1050426168 9:5515114-5515136 TAGTGAACAGAAATGCTTGTGGG - Intronic
1050584380 9:7095088-7095110 AACTGTTAAAAAATGCCTGGGGG + Intergenic
1050764735 9:9118196-9118218 AAGTATTTAAATATGCTTTTAGG + Intronic
1051275977 9:15398865-15398887 AATTTTTCAAAAATGGATGTTGG + Intergenic
1051611236 9:18963603-18963625 TAGTGTATAGAAATGCTTGTGGG + Intronic
1051660861 9:19425449-19425471 AAGTGTTCAAAAATATTTGCTGG - Intronic
1052797462 9:32936606-32936628 AAGGCTTAAAATATGCTTGTGGG - Intergenic
1053492023 9:38514675-38514697 ATTTGTACAAAAATGCGTGTTGG - Intergenic
1054757595 9:68975003-68975025 AAGGTTTAAAAAATGTTTGTTGG + Intronic
1056143290 9:83705541-83705563 ATGTTTTAAAAAATGCTTCTGGG - Intronic
1056690462 9:88804003-88804025 AAGTCTTCAATACTGCTGGTGGG + Intergenic
1056926374 9:90838204-90838226 AAGTCATCAAAAATATTTGTTGG - Intronic
1057672275 9:97103607-97103629 ATTTGTACAAAAATGCATGTTGG - Intergenic
1058399673 9:104600114-104600136 AAATGTTCAAAAACATTTGTTGG + Intergenic
1060322860 9:122581466-122581488 AAATTTTCAAAAATCTTTGTAGG + Intergenic
1061440088 9:130596132-130596154 AAGTGTTCTCAAATTCTTTTTGG - Intronic
1187018242 X:15351518-15351540 AAGTGTTAGAAAATTTTTGTGGG - Intronic
1188782089 X:34297717-34297739 AAGTGATCAAAAATGCCCTTTGG + Intergenic
1188783285 X:34311369-34311391 AAATGTTCATAATAGCTTGTTGG + Intergenic
1189131596 X:38503672-38503694 AATTTTTAAAAAATGTTTGTGGG - Intronic
1192197956 X:69043460-69043482 ATGTCTACAAAAATGCTTGTTGG + Intergenic
1194656400 X:96579266-96579288 ATGTGTTGAAAACAGCTTGTAGG - Intergenic
1194694867 X:97034262-97034284 AAGTGGACTACAATGCTTGTTGG - Intronic
1197520797 X:127494072-127494094 AATTGTACAAAAATGTTTCTAGG + Intergenic
1199364741 X:146967762-146967784 AATTTTTCAAAATTGCATGTGGG + Intergenic
1199673893 X:150168544-150168566 AAGTGCTTGACAATGCTTGTTGG - Intergenic
1200863991 Y:8023120-8023142 AAATTTTCAAATATTCTTGTAGG + Intergenic
1201448624 Y:14085109-14085131 AAGTGCCCAAAAAAGCTTCTGGG - Intergenic
1201609898 Y:15829387-15829409 ATTTGTTCAGAAATGCTGGTGGG + Intergenic