ID: 921827489 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:219689800-219689822 |
| Sequence | AAGTGTTCAAAAATGCTTGT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 292 | |||
| Summary | {0: 1, 1: 0, 2: 5, 3: 26, 4: 260} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921827489_921827490 | 5 | Left | 921827489 | 1:219689800-219689822 | CCTACAAGCATTTTTGAACACTT | 0: 1 1: 0 2: 5 3: 26 4: 260 |
||
| Right | 921827490 | 1:219689828-219689850 | GTACCAGACATTAAACTAGATGG | 0: 1 1: 0 2: 0 3: 12 4: 126 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921827489 | Original CRISPR | AAGTGTTCAAAAATGCTTGT AGG (reversed) | Intronic | ||