ID: 921827489

View in Genome Browser
Species Human (GRCh38)
Location 1:219689800-219689822
Sequence AAGTGTTCAAAAATGCTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 260}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921827489_921827490 5 Left 921827489 1:219689800-219689822 CCTACAAGCATTTTTGAACACTT 0: 1
1: 0
2: 5
3: 26
4: 260
Right 921827490 1:219689828-219689850 GTACCAGACATTAAACTAGATGG 0: 1
1: 0
2: 0
3: 12
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921827489 Original CRISPR AAGTGTTCAAAAATGCTTGT AGG (reversed) Intronic