ID: 921827489 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:219689800-219689822 |
Sequence | AAGTGTTCAAAAATGCTTGT AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 292 | |||
Summary | {0: 1, 1: 0, 2: 5, 3: 26, 4: 260} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
921827489_921827490 | 5 | Left | 921827489 | 1:219689800-219689822 | CCTACAAGCATTTTTGAACACTT | 0: 1 1: 0 2: 5 3: 26 4: 260 |
||
Right | 921827490 | 1:219689828-219689850 | GTACCAGACATTAAACTAGATGG | 0: 1 1: 0 2: 0 3: 12 4: 126 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
921827489 | Original CRISPR | AAGTGTTCAAAAATGCTTGT AGG (reversed) | Intronic | ||