ID: 921838280

View in Genome Browser
Species Human (GRCh38)
Location 1:219800949-219800971
Sequence CATGACCACCACCAAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921838280_921838286 24 Left 921838280 1:219800949-219800971 CCAGCTCCTTGGTGGTGGTCATG 0: 1
1: 0
2: 5
3: 26
4: 238
Right 921838286 1:219800996-219801018 TGTTTGTGGTAAGTGGCATCAGG 0: 1
1: 0
2: 0
3: 11
4: 141
921838280_921838285 17 Left 921838280 1:219800949-219800971 CCAGCTCCTTGGTGGTGGTCATG 0: 1
1: 0
2: 5
3: 26
4: 238
Right 921838285 1:219800989-219801011 TGTCAGCTGTTTGTGGTAAGTGG 0: 1
1: 0
2: 0
3: 9
4: 164
921838280_921838283 -6 Left 921838280 1:219800949-219800971 CCAGCTCCTTGGTGGTGGTCATG 0: 1
1: 0
2: 5
3: 26
4: 238
Right 921838283 1:219800966-219800988 GTCATGATAGATGCTGGTAGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
921838280_921838284 10 Left 921838280 1:219800949-219800971 CCAGCTCCTTGGTGGTGGTCATG 0: 1
1: 0
2: 5
3: 26
4: 238
Right 921838284 1:219800982-219801004 GTAGCGGTGTCAGCTGTTTGTGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921838280 Original CRISPR CATGACCACCACCAAGGAGC TGG (reversed) Intronic
902325303 1:15696247-15696269 CAAGACCAACACCATGGAGAAGG - Intronic
902464206 1:16605114-16605136 CATGACCACCACCATGAAATTGG - Intronic
902688275 1:18093202-18093224 AATGACTGCCACCAGGGAGCTGG - Intergenic
902874504 1:19332752-19332774 CATGACCTGCAGGAAGGAGCAGG - Intergenic
903156895 1:21451564-21451586 CATCACCACCACCATGAAGTTGG + Intronic
903327939 1:22582038-22582060 CAGGCCATCCACCAAGGAGCCGG - Intronic
903334896 1:22618330-22618352 CCTGACGACCAGCCAGGAGCGGG + Intergenic
904273928 1:29368047-29368069 CATGAACACCAGTCAGGAGCAGG + Intergenic
904390561 1:30182873-30182895 CATCACCACCACCAAGGCTGAGG - Intergenic
904486233 1:30826062-30826084 CGTAGCCACCACCTAGGAGCTGG + Intergenic
904600107 1:31668387-31668409 CGTGACCACCACCACAGACCTGG + Intronic
905914967 1:41678410-41678432 CATTCCCACCAACAAGGAGGAGG + Intronic
906026265 1:42676590-42676612 CAAGAACACCACCAAGAAGAAGG - Exonic
906689379 1:47782646-47782668 GAGGAGCACCACCAAGGGGCAGG - Intronic
910596182 1:88983353-88983375 GAGGACCACCACCAAGAAGTGGG - Exonic
911705122 1:101002243-101002265 CATCACTACAACCAAGAAGCTGG + Intronic
912136394 1:106664577-106664599 CATGAAAACCAACAAAGAGCAGG + Intergenic
913541829 1:119828612-119828634 CATCACCACCACCATGAAGTTGG + Intergenic
913545358 1:119862333-119862355 CATCACCACCACCATGAAGTTGG - Intergenic
913992717 1:143629512-143629534 CATCACCACCACCATGAAGTTGG - Intergenic
914362887 1:146951145-146951167 CATCACCACCACCATGAAGTTGG + Intronic
914488783 1:148135978-148136000 CATCACCACCACCATGAAGTTGG - Intronic
917465970 1:175276384-175276406 CATAACCATCCCCAAGGAGAAGG - Intergenic
919795229 1:201317673-201317695 CAGGAGCACCACCAACAAGCTGG + Exonic
919882176 1:201907976-201907998 CATGCCCCCCACCATAGAGCAGG + Intronic
920312753 1:205058256-205058278 CATGAACCCCACCAAGGCACAGG + Exonic
920533813 1:206724172-206724194 CATGCCCATGCCCAAGGAGCAGG + Intronic
921838280 1:219800949-219800971 CATGACCACCACCAAGGAGCTGG - Intronic
922558659 1:226551163-226551185 GAGAACCACCACCAAGGATCAGG - Intronic
924324448 1:242882114-242882136 TCTCACCATCACCAAGGAGCGGG + Intergenic
1062976078 10:1683967-1683989 AAAGACCACCGCCAAAGAGCCGG + Intronic
1064970679 10:21063301-21063323 CATGATCACCATCAAGGACATGG + Intronic
1065034601 10:21624941-21624963 CTTCACCACCACCAAGGGGGAGG - Intronic
1067021872 10:42807584-42807606 CATCAGCACCCCCAAGGAGCTGG + Intronic
1067314830 10:45151508-45151530 GATGACCAGTACCAAAGAGCAGG - Intergenic
1067690234 10:48497113-48497135 CATGATCACCACCTAAGAGCAGG - Intronic
1068219390 10:54025415-54025437 CATGACAACCATCAAGGAAGTGG - Intronic
1069073359 10:64013006-64013028 TATCACCACCTCTAAGGAGCTGG + Intergenic
1069919837 10:71809871-71809893 AATGTCCACCACGAAGTAGCCGG - Exonic
1070785465 10:79159857-79159879 CAAGCCCAACACCAAGGGGCTGG + Intronic
1071412731 10:85412781-85412803 CATGACCTCCTGCATGGAGCAGG - Intergenic
1072718365 10:97766272-97766294 CATGAGCATCACCTGGGAGCTGG - Intergenic
1073701589 10:105933898-105933920 CAAGAACAGCACCAAGGAGATGG - Intergenic
1077486675 11:2841899-2841921 ACTGACCACCCCCCAGGAGCGGG - Intronic
1077741369 11:4849134-4849156 CATGCCCACCAGCAAGAAGGTGG + Exonic
1082075205 11:47970864-47970886 CATGGCCACCACCTGGGAGCTGG - Intergenic
1083436572 11:62647338-62647360 CATGACAGCCACTAAGGTGCAGG + Exonic
1084084786 11:66849991-66850013 CAGGAACTCCACCACGGAGCGGG + Exonic
1084428755 11:69099981-69100003 CATCAGCAACACCAGGGAGCTGG - Intergenic
1085636244 11:78161559-78161581 CATGACCCCCACCACAGAGGAGG - Intergenic
1089294332 11:117458868-117458890 CATCACCACCACGCGGGAGCGGG - Exonic
1089344300 11:117780722-117780744 CACCACCACCCCCACGGAGCTGG + Exonic
1089825445 11:121271753-121271775 CATGTCCAAGACCAAGGTGCTGG + Intergenic
1092085637 12:5756882-5756904 CATGACCACTTCCACAGAGCAGG - Intronic
1092681249 12:10983534-10983556 CATAACTACCACCAAGGGACTGG + Intronic
1092684626 12:11028163-11028185 CATGACCACCACCAAGGGACTGG + Intronic
1092689318 12:11089240-11089262 CATGACCACCACCAAGGGACTGG + Intronic
1092692670 12:11131065-11131087 CATGACCACCACCAAGGGACTGG + Intronic
1095712833 12:45308560-45308582 CATGACCACTACCATTGAGTAGG - Intronic
1096188513 12:49599533-49599555 CACCACCACCACCATGGAGCTGG - Exonic
1096239923 12:49954307-49954329 CATGACCTACCCCAAGGAGGTGG - Exonic
1096579295 12:52574143-52574165 CTTAACCATCAGCAAGGAGCAGG + Intergenic
1101083197 12:101209555-101209577 GATGACCACCACAAAGAAGTAGG + Exonic
1102178468 12:110893680-110893702 CTTGACCAACATCAAGGAGCTGG + Intronic
1102305005 12:111798221-111798243 CATGACCATCGCCAAGGAGGAGG + Exonic
1102381462 12:112470213-112470235 CATTAGCACCACCTGGGAGCTGG - Intronic
1102541347 12:113621481-113621503 CATCACCACCACCCTGGTGCAGG - Intergenic
1103286618 12:119807053-119807075 TATCACCACCACTCAGGAGCTGG + Intronic
1103629791 12:122250953-122250975 CTTTACCACCACAAAGCAGCCGG + Intronic
1104494754 12:129226517-129226539 CATTACCACCTCCAAGGCCCCGG - Intronic
1106527415 13:30553670-30553692 CATGCCCACCATCATTGAGCGGG + Intronic
1106709047 13:32311652-32311674 CAAGCCCAACACCAAGGAGGTGG - Exonic
1108598356 13:51969311-51969333 CATGAGCATCACCTGGGAGCTGG - Intronic
1110411300 13:75206186-75206208 CATGAACAGCACCAAGGGGATGG + Intergenic
1113373379 13:109742217-109742239 CATCAGCATCACCCAGGAGCTGG + Intergenic
1114227384 14:20751709-20751731 AAAGACCCCCACCAAGGAACTGG + Intergenic
1119553271 14:75533145-75533167 CATCAACACCAGCATGGAGCTGG - Intronic
1119670907 14:76517630-76517652 CATCACCACCTCCAAGAAGCTGG + Intergenic
1121999637 14:98636176-98636198 CCTCACCCCCACCAAGTAGCTGG - Intergenic
1122950621 14:105042515-105042537 CATGAGCACCCCCCAGAAGCAGG + Intergenic
1123101499 14:105804970-105804992 CATGACCACCACCACCGTGGGGG + Intergenic
1125507015 15:40272855-40272877 CATGATCACCACCTGGGGGCAGG - Exonic
1126336779 15:47593881-47593903 CAAGAACACCACCAAGGGGATGG + Intronic
1129751236 15:78066025-78066047 GATCACCACCACCAAAGAGCTGG - Intronic
1130156908 15:81358443-81358465 GAAGACCATCCCCAAGGAGCAGG - Exonic
1131345882 15:91647676-91647698 CAAGTCCACGACCAAGGTGCTGG - Intergenic
1132156994 15:99502777-99502799 CCTGACAAAGACCAAGGAGCTGG + Intergenic
1132718503 16:1304199-1304221 GGTGACCACCACCAAGGAAGCGG + Intergenic
1132763143 16:1520751-1520773 CATGAGCATCACCGAGGAGATGG - Exonic
1133085629 16:3360567-3360589 CAAAACCACCACCAAGGGCCGGG + Intergenic
1134607819 16:15584903-15584925 CATTACCATCACCAAGAGGCTGG + Intronic
1135643680 16:24142915-24142937 CATGCCCAGCACTAGGGAGCAGG - Intronic
1136090027 16:27912070-27912092 CCTGACCACCACAAAGCAGGTGG - Intronic
1136703477 16:32164964-32164986 CATTCCCACCACCAGGGGGCAGG - Intergenic
1136764225 16:32762636-32762658 CATTCCCACCACCAGGGGGCAGG + Intergenic
1136803873 16:33107750-33107772 CATTCCCACCACCAGGGGGCAGG - Intergenic
1137793442 16:51194730-51194752 CTTGAGCACCTCCAAGGAGTAGG + Intergenic
1138030101 16:53553002-53553024 GCTGACCACCAGCAAGGAGACGG + Intergenic
1138129962 16:54471249-54471271 CATGACCACTAGCAAAGAGAAGG - Intergenic
1139193480 16:64891790-64891812 CATGCCCAGCTCCAAGGATCAGG + Intergenic
1139557995 16:67724777-67724799 CATGTCCACCAATATGGAGCAGG + Exonic
1139647069 16:68339028-68339050 CAGGATCACCACCCAGCAGCAGG + Intronic
1141671083 16:85492006-85492028 CACCACCACCACCGAGGTGCTGG + Intergenic
1141692901 16:85606626-85606648 CAGGCCCACCACCAGGGTGCAGG + Intergenic
1203066579 16_KI270728v1_random:1024759-1024781 CATTCCCACCACCAGGGGGCAGG + Intergenic
1143524301 17:7463313-7463335 CATGGCCACCACCACGGAGGAGG - Exonic
1143556866 17:7667611-7667633 CATCTCCACCACCAGGGAGGAGG + Intronic
1144785117 17:17827183-17827205 CAGGACGGCCACCAAGGAGCTGG + Intronic
1144789148 17:17847884-17847906 CATGAAGCCCACCTAGGAGCAGG + Intronic
1146965738 17:37028301-37028323 CCCGACCACCACCAAGGAGCTGG - Intronic
1146988805 17:37248118-37248140 CATGATCACCACATAGGAGTTGG + Exonic
1148748780 17:49932592-49932614 CAGGACCCCCCCCCAGGAGCAGG - Intergenic
1149557411 17:57584042-57584064 CATCCACACCACCAGGGAGCTGG - Intronic
1151270916 17:72995364-72995386 CATAACCAGCTCCAAGGAGAGGG + Intronic
1151524888 17:74658267-74658289 TAAGACCACCCCCATGGAGCCGG - Intergenic
1151732169 17:75917967-75917989 CCTCACCACCTCCCAGGAGCGGG - Exonic
1151916147 17:77119480-77119502 GAGGAGCACCATCAAGGAGCCGG + Intronic
1152269717 17:79317059-79317081 CATGAAGACCGACAAGGAGCTGG + Intronic
1152583258 17:81178354-81178376 CATGACCACCCCACAGGGGCAGG + Intergenic
1153896797 18:9570208-9570230 CATGGCCACCAGAAAGGAACTGG - Exonic
1154266602 18:12884120-12884142 CATGCCCACCACCATCGAGCGGG - Exonic
1154335020 18:13457987-13458009 AATGACCACCACCATGGTGCTGG - Intronic
1155930397 18:31701202-31701224 CAAGAACAGCACCAAGGAGATGG - Intergenic
1156419229 18:36933282-36933304 CACCACCACCACCACAGAGCAGG - Intronic
1156721094 18:40070858-40070880 CAAGAACAGCACCAAGGGGCTGG - Intergenic
1158741669 18:60149568-60149590 CTTGCCCACCACCATGGTGCTGG - Intergenic
1161154616 19:2726188-2726210 CATCACCACCTCTAAGGAGTGGG + Intronic
1161769284 19:6222576-6222598 CAAGAGCTCCTCCAAGGAGCTGG - Exonic
1163277860 19:16296779-16296801 CATCACCACCTTCAAGGGGCGGG - Intergenic
1163466664 19:17471786-17471808 CATCAGAACAACCAAGGAGCCGG - Intronic
1164051334 19:21587339-21587361 CCTGCCCACCAACCAGGAGCGGG - Intergenic
1164632240 19:29769289-29769311 CATGACCATTCCTAAGGAGCGGG + Intergenic
1164633402 19:29776132-29776154 CAGGCCTGCCACCAAGGAGCCGG - Intergenic
1165192101 19:34073381-34073403 CAAGAACAGCACCAAGGGGCTGG - Intergenic
1166161092 19:40953855-40953877 CAAGGGCACCAGCAAGGAGCTGG - Intergenic
1166976537 19:46608240-46608262 CACTATCACCACCAAGGAGTTGG + Exonic
1167357803 19:49014811-49014833 CCTGACCACCCCCAGGGCGCTGG - Intronic
1167749662 19:51372052-51372074 CATGGCCACCACCATGGAGATGG + Exonic
1167765803 19:51481426-51481448 CATGTTCTCCACCAGGGAGCTGG - Exonic
1168338367 19:55609774-55609796 CACCACCACCACCAAGGGACAGG - Intronic
925357755 2:3254089-3254111 CAAAACCACCACCAAGCACCTGG + Intronic
926177412 2:10607280-10607302 AAGGAACACCACCGAGGAGCAGG + Exonic
927460471 2:23294279-23294301 CATCCCCACCACCCAGGACCTGG + Intergenic
928070107 2:28206508-28206530 CATCACCACCATCAAGAACCCGG - Intronic
929453888 2:42053283-42053305 CCTGACCACCATCACGGAGCTGG + Exonic
929578095 2:43065258-43065280 CAAGTCCACCACAGAGGAGCAGG + Intergenic
931499233 2:62845747-62845769 CATGTCAACCTCCAAGTAGCTGG - Intronic
932416786 2:71578393-71578415 CATTTCCCCCACCAAGCAGCAGG - Intronic
934170629 2:89538349-89538371 CATGATCACCACGATGGAGTAGG - Intergenic
934280931 2:91612669-91612691 CATGATCACCACGATGGAGTAGG - Intergenic
942611941 2:177751273-177751295 AATGACAACCACCAAGGAGAAGG - Intronic
945049964 2:205814323-205814345 CATGACAACCATCAAGGAATAGG + Intergenic
945974408 2:216259266-216259288 CATGACCACCACTGAGGGCCCGG - Exonic
948148010 2:235723041-235723063 CATGACCACCACCAAGTGATGGG - Intronic
948377272 2:237529810-237529832 CATCACCATGCCCAAGGAGCTGG - Intronic
948712536 2:239833881-239833903 CATCAACCCCACCAAGGAGATGG + Intergenic
948773764 2:240269410-240269432 CCTGACCAGGAGCAAGGAGCTGG - Intergenic
1174049868 20:47760127-47760149 CATGGACACCAACGAGGAGCTGG + Intronic
1175147861 20:56910370-56910392 CCTGACCACCACAAAGCAGATGG - Intergenic
1175567195 20:59989564-59989586 CGTGAACACGTCCAAGGAGCTGG - Intronic
1175616939 20:60407701-60407723 CATGACCACTTCCAAACAGCAGG - Intergenic
1175627216 20:60499651-60499673 TATAACCACCAACAGGGAGCTGG - Intergenic
1175933172 20:62502935-62502957 CATGATCAGGTCCAAGGAGCGGG - Intergenic
1176151564 20:63594020-63594042 CAACACCACCACCAACGACCTGG + Intronic
1176377275 21:6092838-6092860 CAGGAAGGCCACCAAGGAGCAGG - Intergenic
1179214859 21:39358694-39358716 CATAACCATCCCCAAGGAGAAGG - Intergenic
1179649753 21:42800392-42800414 CACCACCACCACCAAAGAGGTGG - Intergenic
1179746200 21:43445406-43445428 CAGGAAGGCCACCAAGGAGCAGG + Intergenic
1180946943 22:19700469-19700491 CAAGAACACCACCAAGGGGATGG + Intergenic
1183442775 22:37832636-37832658 GATGACCAGTACCAAAGAGCAGG - Exonic
1183908132 22:41058327-41058349 CACCTCCACCTCCAAGGAGCTGG + Intergenic
1184186036 22:42866146-42866168 CATGACCACCACCAGGCACAGGG - Intronic
1184632084 22:45789660-45789682 CACCACCACCACAAAGGGGCTGG - Intronic
1184987204 22:48144045-48144067 CAGGTCCACCACCAAGGGCCAGG - Intergenic
950263779 3:11560390-11560412 CAGGACAGCCAGCAAGGAGCTGG + Intronic
950771430 3:15314594-15314616 GATGAAGACCACCAGGGAGCTGG + Intronic
951238078 3:20257959-20257981 AAAGACCAGCACCAAGGAGGGGG + Intergenic
952859340 3:37799838-37799860 CGTCATCACCACCAATGAGCTGG - Intronic
954071626 3:48147036-48147058 GATGACCATCTCCAAGGTGCTGG - Intergenic
954078614 3:48199290-48199312 CATGACAACCCCCAAGGACTTGG - Intergenic
955933832 3:64083317-64083339 GCTGACCACCCTCAAGGAGCTGG - Intergenic
958445107 3:94205351-94205373 CATGACCATCACTGAGGACCTGG - Intergenic
958822282 3:98989107-98989129 CAAGAACAACACCAAGGAGATGG - Intergenic
958906231 3:99945119-99945141 CATGACCACCAAAAAGCATCAGG - Intronic
961351680 3:126308263-126308285 CTTGACCACCCCCAAGGAGCTGG + Intergenic
961360085 3:126361455-126361477 AAGGAGCAGCACCAAGGAGCAGG + Intergenic
961371200 3:126433114-126433136 GATGTCCATCACCAAGGAGGAGG + Exonic
966758845 3:183396971-183396993 CAAGTCCACCATCAAGGTGCTGG - Intronic
967480406 3:189966248-189966270 CCTGACCAGCACCAGGGAGTGGG - Intronic
968056778 3:195697729-195697751 CAAGACTCCCACCCAGGAGCGGG - Intergenic
968727958 4:2256905-2256927 CTTGACCAGGACCCAGGAGCCGG - Intronic
968800897 4:2742756-2742778 CAGGACTTCCACCAAGGGGCTGG - Intronic
970343559 4:15131238-15131260 CCTGAACATCACCAATGAGCTGG - Intergenic
970352397 4:15215960-15215982 CAAGAACAGCACCAAGGAGATGG - Intergenic
970803841 4:20006811-20006833 CAGGCCCACCACCAGAGAGCTGG + Intergenic
975406373 4:73995136-73995158 CATGAGCTCTGCCAAGGAGCTGG + Intergenic
976493667 4:85700569-85700591 CATTACCACCACCCATCAGCTGG - Intronic
978494742 4:109346989-109347011 GAAGACCACCACCAAGAAGTGGG - Intergenic
979702924 4:123688507-123688529 CAAGAACAGCACCAAAGAGCTGG + Intergenic
980147098 4:129000829-129000851 CATTACCATCACCTAGAAGCTGG + Intronic
980363315 4:131765345-131765367 CAAGAACAGCACCAAGGAGATGG + Intergenic
981427135 4:144616538-144616560 CATGACCACAACAAAGTAGCTGG + Intergenic
982055928 4:151548805-151548827 CATTTCCAACACCAAGTAGCTGG - Intronic
985817819 5:2139633-2139655 CATGACACACACCAAGGACCAGG + Intergenic
987081331 5:14427710-14427732 CATGACCCCCACCAAAGAACTGG - Intronic
989111028 5:37906844-37906866 CCAGGACACCACCAAGGAGCCGG - Intergenic
989368603 5:40681820-40681842 GATGAGCACCACCAGGGAGGTGG - Exonic
994709021 5:103243422-103243444 CATCACCACCACCCCGGAACTGG + Intergenic
994872359 5:105367918-105367940 CATTCCCACCACCAATGTGCAGG - Intergenic
997423152 5:133785217-133785239 CATGACCATCAGGAAGGAACAGG - Intergenic
1000038834 5:157469672-157469694 CAGGACCCCCACAGAGGAGCTGG - Intronic
1001877247 5:175212404-175212426 CATGATCTCCTCCAAGGAGCAGG - Intergenic
1002484960 5:179528898-179528920 CAGAACCAGCAGCAAGGAGCAGG - Intergenic
1004151351 6:13123185-13123207 CATTACCTACACCCAGGAGCTGG - Intronic
1004900670 6:20190851-20190873 CCTGACCACCACCAGGGACAGGG + Intronic
1005992733 6:30913713-30913735 CAGGGCTGCCACCAAGGAGCTGG + Intronic
1008662939 6:53687469-53687491 CATGACCCCCCTCACGGAGCTGG - Intergenic
1010259970 6:73804522-73804544 CAACACCACCACCTAAGAGCGGG - Intronic
1013244703 6:108275376-108275398 GAGGACCATCACAAAGGAGCAGG - Intergenic
1014282349 6:119455800-119455822 GATGAGCACCAGTAAGGAGCAGG - Intergenic
1014610187 6:123533724-123533746 CAAGACCACCACTCAGGAGAAGG + Intronic
1018094215 6:160371146-160371168 CATGCCTCCCACCCAGGAGCAGG + Intronic
1019308891 7:349379-349401 CCTGACCTGCACCAAGGACCGGG + Intergenic
1019461189 7:1159833-1159855 CCTGACCTCCAGCAAGCAGCCGG + Intronic
1019479455 7:1259925-1259947 CAGGACCACCACGAGGGAGGAGG - Intergenic
1020086290 7:5312601-5312623 CCTCCCCACCACCAAGGAGCTGG - Exonic
1021901025 7:25285762-25285784 CATCAGCATCACCTAGGAGCTGG - Intergenic
1022443666 7:30452918-30452940 CATGGACACCATCATGGAGCTGG - Exonic
1023081302 7:36528971-36528993 AATCAACACCACCCAGGAGCTGG - Intronic
1024235352 7:47393567-47393589 CATGAGCACCCCCAGGGAGGTGG - Intronic
1024594715 7:50922401-50922423 CATGTCCACCACAATGGATCCGG + Intergenic
1025208017 7:57004471-57004493 CCTCCCCACCACCAAGGAGCTGG + Intergenic
1025663936 7:63572404-63572426 CCTCCCCACCACCAAGGAGCTGG - Intergenic
1026612032 7:71868668-71868690 CAAGACTAGCACCAAGGAGATGG + Intronic
1026920811 7:74153989-74154011 CTTGACCTCCACCAAGGACCTGG + Intergenic
1028148995 7:87350662-87350684 CATAACCATCCCCAAGGAGAAGG + Intronic
1030628070 7:111865580-111865602 CAGGAACACCACCAGGGAACAGG - Intronic
1030633381 7:111919941-111919963 CATGACCACAACCAAGAGGCTGG + Intronic
1031760248 7:125705169-125705191 CAAGGACAGCACCAAGGAGCTGG - Intergenic
1031887765 7:127258829-127258851 CATCACCACCACCAATGATATGG + Intergenic
1032402425 7:131633148-131633170 CAAGACCACCAGCAAGGGTCAGG - Intergenic
1033267663 7:139899881-139899903 CATGCTCACCACCAAGGACCTGG + Intronic
1033598991 7:142875760-142875782 TATCATCACCACCAAGAAGCGGG - Exonic
1034353403 7:150432055-150432077 CCTCAGCACCACCATGGAGCAGG - Intergenic
1035019732 7:155793879-155793901 CTTGGCCTCCACCAAGGAGCAGG - Intergenic
1035395501 7:158532187-158532209 CATGGGCACCACCCAGGTGCTGG - Intronic
1038405849 8:27322103-27322125 CCTCAGCCCCACCAAGGAGCTGG + Intronic
1039113459 8:34065584-34065606 CATGTCCACTACGAAGGAGGGGG + Intergenic
1039877656 8:41601208-41601230 CATGAGCATCGCCAAGCAGCTGG + Intronic
1042279895 8:67044684-67044706 CATCACCTCCACCCAGGAGGTGG - Intronic
1047937472 8:129797012-129797034 CTTGACCACCAGCAGGGAGGTGG + Intergenic
1048980868 8:139702990-139703012 CATGGCCGCCAGCAAGGAGCCGG + Exonic
1052605160 9:30689556-30689578 GAGGACCACCACCAAGAAGTGGG + Intergenic
1052939225 9:34118847-34118869 CTTCAGCACCACCAAGTAGCTGG - Intronic
1053627471 9:39889631-39889653 CAAGAACAGCACCAAGGAGATGG + Intergenic
1053778520 9:41576390-41576412 CAAGAACAGCACCAAGGAGATGG - Intergenic
1054166482 9:61786634-61786656 CAAGAACAGCACCAAGGAGATGG - Intergenic
1054216416 9:62361072-62361094 CAAGAACAGCACCAAGGAGATGG - Intergenic
1054671065 9:67794271-67794293 CAAGAACAGCACCAAGGAGATGG + Intergenic
1061534877 9:131241416-131241438 CCTGACCACCTCCAAGTATCTGG + Intergenic
1061948662 9:133923221-133923243 CATGACCACCAGCTGTGAGCGGG - Intronic
1062215035 9:135384531-135384553 CATGGCAACCCCCCAGGAGCCGG + Intergenic
1186253750 X:7697802-7697824 CATTTCCACCACCAAAGTGCAGG - Intergenic
1191892316 X:65956722-65956744 GAGGACCACCACCAAGAAGTGGG - Intergenic
1194048973 X:89044398-89044420 CCTCAGCACCACCAAGTAGCTGG - Intergenic
1196493250 X:116292771-116292793 CATAACCATCCCCAAGGAGAAGG - Intergenic
1196831260 X:119777358-119777380 CACGACCACCCCCAGGAAGCTGG + Intergenic
1198462422 X:136876570-136876592 GAGGACCACCACCAAGAAGTGGG - Exonic
1199569014 X:149248475-149248497 CATGACCATCACTCTGGAGCTGG - Intergenic
1201221987 Y:11781116-11781138 TCTCACCATCACCAAGGAGCGGG + Intergenic