ID: 921839128

View in Genome Browser
Species Human (GRCh38)
Location 1:219809751-219809773
Sequence GCAGGAAATGCGGTGGCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921839128_921839140 14 Left 921839128 1:219809751-219809773 CCAGCCGCCACCGCATTTCCTGC No data
Right 921839140 1:219809788-219809810 ATCAGGTTTGGAGGTGGTAGGGG 0: 1
1: 0
2: 3
3: 36
4: 273
921839128_921839136 5 Left 921839128 1:219809751-219809773 CCAGCCGCCACCGCATTTCCTGC No data
Right 921839136 1:219809779-219809801 GTTCTGCATATCAGGTTTGGAGG 0: 1
1: 0
2: 0
3: 7
4: 122
921839128_921839138 12 Left 921839128 1:219809751-219809773 CCAGCCGCCACCGCATTTCCTGC No data
Right 921839138 1:219809786-219809808 ATATCAGGTTTGGAGGTGGTAGG 0: 1
1: 0
2: 2
3: 24
4: 198
921839128_921839134 -3 Left 921839128 1:219809751-219809773 CCAGCCGCCACCGCATTTCCTGC No data
Right 921839134 1:219809771-219809793 TGCTTCAGGTTCTGCATATCAGG 0: 1
1: 0
2: 1
3: 18
4: 258
921839128_921839141 18 Left 921839128 1:219809751-219809773 CCAGCCGCCACCGCATTTCCTGC No data
Right 921839141 1:219809792-219809814 GGTTTGGAGGTGGTAGGGGATGG No data
921839128_921839142 25 Left 921839128 1:219809751-219809773 CCAGCCGCCACCGCATTTCCTGC No data
Right 921839142 1:219809799-219809821 AGGTGGTAGGGGATGGTCGTAGG 0: 1
1: 0
2: 2
3: 14
4: 269
921839128_921839139 13 Left 921839128 1:219809751-219809773 CCAGCCGCCACCGCATTTCCTGC No data
Right 921839139 1:219809787-219809809 TATCAGGTTTGGAGGTGGTAGGG 0: 1
1: 0
2: 0
3: 17
4: 146
921839128_921839137 8 Left 921839128 1:219809751-219809773 CCAGCCGCCACCGCATTTCCTGC No data
Right 921839137 1:219809782-219809804 CTGCATATCAGGTTTGGAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 127
921839128_921839135 2 Left 921839128 1:219809751-219809773 CCAGCCGCCACCGCATTTCCTGC No data
Right 921839135 1:219809776-219809798 CAGGTTCTGCATATCAGGTTTGG 0: 1
1: 0
2: 0
3: 7
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921839128 Original CRISPR GCAGGAAATGCGGTGGCGGC TGG (reversed) Intronic
No off target data available for this crispr