ID: 921847387

View in Genome Browser
Species Human (GRCh38)
Location 1:219898536-219898558
Sequence CGTGTTTTGTGACCAAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 113}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921847387_921847392 14 Left 921847387 1:219898536-219898558 CCCTGTTTTGGTCACAAAACACG 0: 1
1: 0
2: 1
3: 8
4: 113
Right 921847392 1:219898573-219898595 AGATCTTTTCTTAAAGCACTTGG 0: 1
1: 0
2: 1
3: 18
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921847387 Original CRISPR CGTGTTTTGTGACCAAAACA GGG (reversed) Intronic
902229452 1:15018687-15018709 AGTGTTTTGTGACCGAAAGGGGG + Intronic
904383422 1:30126260-30126282 AGTCTTTTGTAACCAAATCATGG - Intergenic
906988372 1:50711407-50711429 TATGTTTGGTGATCAAAACAAGG - Intronic
910114298 1:83715397-83715419 CCTGCTCTGTGACAAAAACATGG - Intergenic
911172380 1:94783380-94783402 TGTGTTTTCTGAGCAGAACAAGG - Intergenic
917364284 1:174212216-174212238 CTTGTTTTGTGACCTAAGTACGG - Intronic
918389915 1:184048469-184048491 TGTGTTTTGTGTACAAAAAAAGG + Intergenic
921822455 1:219632992-219633014 TGTGTTTTGAAACCTAAACAAGG - Intergenic
921847387 1:219898536-219898558 CGTGTTTTGTGACCAAAACAGGG - Intronic
923046491 1:230359885-230359907 CCTGTTTGGTGCCCAAAAAATGG - Intronic
924470300 1:244337356-244337378 CGTGGTTAGTGACCACAACAGGG - Intergenic
1069417201 10:68211107-68211129 CTTATTTTGTGGCCAAAGCATGG + Exonic
1071440370 10:85686362-85686384 CATGTCTTGTGAACAACACATGG - Intronic
1072012848 10:91319195-91319217 CGTGTGTAATGATCAAAACAGGG - Intergenic
1079194217 11:18311081-18311103 CTGGTTTGGTGACTAAAACAAGG - Intronic
1086997938 11:93380058-93380080 CATGTTTGGTCACCACAACAAGG + Intronic
1090155188 11:124429943-124429965 CTTGTTTTTAGAGCAAAACACGG - Intergenic
1090562355 11:127946144-127946166 AGTGTTCTGTGGCCAAATCAAGG + Intergenic
1093542254 12:20301021-20301043 AGTCTTTTGTGACCTAATCATGG - Intergenic
1094256466 12:28434125-28434147 TGTCTTTTGTGAACAAAAGATGG + Intronic
1095915031 12:47469397-47469419 CTTGTGTTGAGTCCAAAACATGG + Intergenic
1098214387 12:68200255-68200277 CATGGTTTGTGACCAAGACTGGG + Intergenic
1106998854 13:35521074-35521096 TGTGATTTGAAACCAAAACAAGG - Intronic
1111468957 13:88651375-88651397 CTTGTTTTGTGACCTAAATATGG + Intergenic
1112062389 13:95754389-95754411 AGTTTTTTGTGACCTAATCAAGG + Intronic
1113915703 13:113871888-113871910 CTTGTTTTGTGGCCAGAAGATGG + Intergenic
1120347317 14:83307335-83307357 AGTGTTTTGTGACCAGAGGAAGG - Intergenic
1123479571 15:20618343-20618365 GGTGTTTTGTTATCAAAACTGGG - Intergenic
1123638436 15:22382021-22382043 GGTGTTTTGTTATCAAAACTGGG + Intergenic
1124246839 15:28078453-28078475 AGTCTTTTGTGACCTAATCATGG - Intronic
1125362016 15:38874398-38874420 GGTGTATTTTGACTAAAACAGGG + Intergenic
1130185346 15:81675594-81675616 TGTGTTTTGTAACCACAAAAAGG + Intergenic
1131020904 15:89097848-89097870 CATGTTAAGTGACTAAAACAAGG - Intronic
1134187998 16:12099483-12099505 AGTATTTAGTGACCTAAACAGGG + Intronic
1135153345 16:20030277-20030299 CATTTTTGGTGACCAAAAAACGG - Intergenic
1135851656 16:25969278-25969300 AGTGTTTTTGGAGCAAAACATGG + Intronic
1138092464 16:54187178-54187200 TGTGTTTTGATACCAAAAAAAGG + Intergenic
1140868479 16:79085149-79085171 CATGTTTAGGGACAAAAACACGG + Intronic
1145054062 17:19687034-19687056 CTTGTTTTGTGACTCAAATATGG - Intronic
1149326352 17:55534355-55534377 GGTGTTATGTGACTAAAACATGG + Intergenic
1149625536 17:58077857-58077879 CCTCTTTTGTGACCAAAAGGTGG + Intergenic
1151346090 17:73502435-73502457 CATTTTTTGAGCCCAAAACAAGG + Intronic
1152844343 17:82590805-82590827 CGAGTTTTCTGACCCAAGCATGG + Intronic
1152879188 17:82805668-82805690 CGTGTTTTGTGGCCCACACCAGG + Intronic
1153108626 18:1558379-1558401 CTTGTTTTGTCACCAAAATATGG + Intergenic
1155470591 18:26188023-26188045 CTTATTTTGTGACCTAAATATGG - Intronic
1158616318 18:58991000-58991022 CCTGTTTTGTGCCCAACACACGG - Intergenic
1159518836 18:69493336-69493358 CATGTTTAGTGGCCAAGACATGG + Intronic
1162786707 19:13039586-13039608 CATGTCTTGTCACGAAAACAGGG + Intronic
1163126708 19:15248173-15248195 CTGGATTTGTGACCAAAAAAGGG + Intronic
928922104 2:36536991-36537013 CCTGTTTTGTAAACAATACAGGG - Intronic
929320348 2:40536328-40536350 AGTGTTTTATTACCAAAAGAGGG + Intronic
930165590 2:48200721-48200743 CCTGGTTTTTGACCAAAGCAAGG + Intergenic
931714953 2:65021522-65021544 GGTGTTTTCTGAGCAAACCAAGG + Exonic
932525168 2:72458303-72458325 TCTGTTTTGTGACTAATACAGGG + Intronic
937031942 2:118747953-118747975 AGTGCTGTGTGACCAAAACTGGG + Intergenic
937478182 2:122233688-122233710 CCTTTGTTGTGACCAAGACAGGG + Intergenic
938743577 2:134255757-134255779 TGTGTTTTGTGACCCACTCAAGG + Intronic
939239564 2:139539980-139540002 CTTGTTTAGTGACTAAAATAAGG + Intergenic
939441585 2:142257852-142257874 CTTGTTTTGTGGCCAAAATGTGG + Intergenic
939838631 2:147159290-147159312 AATGTTTAGTGACCAAATCAGGG + Intergenic
942982377 2:182097632-182097654 TGTATTTTGTGACAGAAACAAGG + Intronic
943017838 2:182535813-182535835 AGTGTTCTGTGACACAAACATGG - Intergenic
945976039 2:216271553-216271575 CTAGTTTTGGGAACAAAACAAGG + Intronic
1169028200 20:2387212-2387234 TGTGTTTTCTGACTAAACCAAGG + Intronic
1170401305 20:15986171-15986193 CCTGTTTTGAGAGAAAAACAAGG - Intronic
1172172470 20:32947438-32947460 TGTGTTTTGTTACCAGAATATGG - Intronic
1182017128 22:27050242-27050264 CATCTTTAGTGACCAGAACAAGG + Intergenic
1184527476 22:45033810-45033832 CTTTTTTTGTGAGCTAAACAAGG - Intergenic
1185231118 22:49683915-49683937 TTTGTTTTATGACCAAAATATGG + Intergenic
957352265 3:79040684-79040706 GGTGTTTTGTGTCTACAACAAGG - Intronic
957633711 3:82753695-82753717 CTTGTTTTATGACCCAAATATGG + Intergenic
961416515 3:126762533-126762555 CTTGTTTTGTGCCCAATATATGG + Intronic
964208790 3:154204918-154204940 CTTGTTTTGTGACCTAAATATGG + Intronic
967900546 3:194446628-194446650 GATTTTTTGTGACCAAAATATGG + Intronic
970153094 4:13110941-13110963 CTTGTTTTGTGGCCTAAATATGG - Intergenic
971800749 4:31287007-31287029 AGTGTTTTGTGACAAACACCTGG - Intergenic
976352832 4:84080056-84080078 TGTGTTTTGTGCGTAAAACAAGG - Intergenic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
985262555 4:188128435-188128457 TGAGTTTTGTGACCAAAAGGAGG - Intergenic
986204688 5:5612363-5612385 CTGCTTTTGTGCCCAAAACAAGG - Intergenic
987418463 5:17690251-17690273 CATTTTTTGTGACCAAAAGTAGG + Intergenic
987555539 5:19442123-19442145 AGTATTTTGTGACCCAAGCAGGG + Intergenic
989666925 5:43865218-43865240 CGTGGTTGGTTACCAAAGCATGG + Intergenic
991142873 5:63266185-63266207 TGTGTTATGTTACAAAAACATGG - Intergenic
992003003 5:72453355-72453377 TGTGTTTTGTTGCCATAACAGGG - Intronic
993418946 5:87675704-87675726 CTTGTTCAGTGACTAAAACATGG + Intergenic
993762957 5:91819659-91819681 GGTATTTTGTTACCAAAAGAAGG - Intergenic
995911695 5:117195404-117195426 CTTGTTTTGTATCTAAAACAGGG - Intergenic
997803181 5:136887722-136887744 CTGGTTTTCTCACCAAAACAGGG - Intergenic
1000040244 5:157479918-157479940 TGTGTTTTGTGACCTCAGCAGGG - Exonic
1000237387 5:159375099-159375121 CTTGCTTTGTGGCCTAAACATGG + Intergenic
1001823338 5:174726320-174726342 TGTATTTTGTTAACAAAACAAGG + Intronic
1004217415 6:13715694-13715716 AGTGTTTTGTAACCCAACCACGG + Intergenic
1006287293 6:33106466-33106488 GGTGTGTTGTGGCCAAAAGAAGG + Intergenic
1008536582 6:52510599-52510621 AGTGTTTGCTGACCAACACAGGG + Intronic
1009373276 6:62935571-62935593 CTTGTTTTGTGACTAAAATGTGG + Intergenic
1009861094 6:69333324-69333346 TGTTCTTTGTGACCAAAACCAGG - Intronic
1010546001 6:77157333-77157355 CATCTTTTCTGACCACAACAAGG - Intergenic
1019079441 6:169420227-169420249 TGTGTTTTCTTACGAAAACAAGG + Intergenic
1023280411 7:38563736-38563758 AGTGCTCTGTTACCAAAACATGG + Intronic
1025998626 7:66544173-66544195 GTTGTTTTGTGCCCAACACAGGG + Intergenic
1026991584 7:74589015-74589037 GTTGTTTTGTGCCCAACACAGGG + Intronic
1029226330 7:99031216-99031238 CTTGATCTGAGACCAAAACAGGG + Intronic
1034348169 7:150399581-150399603 CATGTTTTGTGATCAAAGAACGG - Intronic
1034536243 7:151727672-151727694 GCTGTTCTGTGATCAAAACAGGG + Intronic
1035079874 7:156207036-156207058 CGTGACTTGTGACCAAAACAAGG - Intergenic
1036746931 8:11416476-11416498 CGTGTCTAGTGATCAAATCAGGG + Intronic
1037629500 8:20640993-20641015 CATCTGTTGTTACCAAAACATGG + Intergenic
1047740034 8:127798949-127798971 TGGATTTTGTGACCAAAACTAGG + Intergenic
1048635501 8:136291040-136291062 AGTGTTTAATGACCAAATCAGGG - Intergenic
1059097077 9:111429437-111429459 GGTGTTTTGTGACCCTAAAAAGG + Intronic
1060338131 9:122746130-122746152 TTTGTTATGTGACAAAAACAAGG - Intergenic
1186875310 X:13810690-13810712 CGTGTTTTCTGAGAAAAACATGG + Intronic
1187012496 X:15294336-15294358 CTTTTTTTGTGTCCAAAGCAAGG - Intronic
1187661594 X:21552405-21552427 AGTATTATGTGACCAAAAAAGGG - Intronic
1189735988 X:44070442-44070464 AATGTTTTGTGATCAAAACATGG + Intergenic
1192062914 X:67848602-67848624 CTTGTTTTGTGAACTATACATGG - Intergenic
1194883016 X:99277259-99277281 CTTGTTTTGTGACCTACATATGG - Intergenic
1195391533 X:104367345-104367367 TGTGTTTTGTTATCAAAACCAGG + Intergenic
1195844325 X:109209684-109209706 TGTGTTTTGAGCCCAAAACTGGG - Intergenic
1200939365 Y:8766044-8766066 AGTGTTCTGTGGCCAAACCAGGG - Intergenic
1201617466 Y:15917428-15917450 CATGATTTGTTACTAAAACATGG - Intergenic