ID: 921850889

View in Genome Browser
Species Human (GRCh38)
Location 1:219930610-219930632
Sequence GAGGCTTATCTGGTGTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921850889_921850894 13 Left 921850889 1:219930610-219930632 CCACCTTACACCAGATAAGCCTC 0: 1
1: 0
2: 0
3: 6
4: 81
Right 921850894 1:219930646-219930668 TATTAAATATTTGCACCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921850889 Original CRISPR GAGGCTTATCTGGTGTAAGG TGG (reversed) Intronic
900299006 1:1967456-1967478 GAGGCTTCTCTGGAGCAAGGAGG + Intronic
901078959 1:6572863-6572885 GAGGCTTTTGTTGTGTAGGGAGG - Intronic
903550630 1:24155533-24155555 GAGGCTGCTCTGGTGAAAGTGGG + Exonic
921850889 1:219930610-219930632 GAGGCTTATCTGGTGTAAGGTGG - Intronic
922550404 1:226490302-226490324 GAGACATATTTGGTGTAAGCTGG + Intergenic
922654670 1:227371236-227371258 GAGGCTTATTTCTTGAAAGGAGG - Intergenic
1063394841 10:5677264-5677286 TAGATTTATCTGGTGGAAGGAGG - Intergenic
1065208755 10:23382246-23382268 GTGGATTGTCTGGGGTAAGGAGG + Intergenic
1066627263 10:37419473-37419495 AAGGCTCATCTGGTGCAAGAAGG - Intergenic
1071017402 10:81014043-81014065 GAGGCTTTTGTGGTTTGAGGTGG - Intergenic
1073327988 10:102653509-102653531 GAGGCATATCTGGTGAGAGGAGG + Intronic
1076571425 10:131435830-131435852 CAGGCTCCTCTGGTGAAAGGTGG - Intergenic
1086980268 11:93189040-93189062 GAGGCTTTGCTGGAGTAGGGAGG - Intronic
1087134014 11:94695876-94695898 GAGGCTTCTCTGGTTGAAGGTGG + Intergenic
1087512111 11:99109518-99109540 ATGGCTTATCTGGTTTAAAGAGG - Intronic
1089292117 11:117443693-117443715 GAGGCTTTGCTGGAGTCAGGGGG + Intronic
1090102514 11:123815185-123815207 GAGGCATATCTAGTGAAAGCAGG - Intergenic
1090502146 11:127271619-127271641 GAGGCTCATCAGGTAGAAGGAGG + Intergenic
1094749586 12:33390406-33390428 GAGGATTATCTGATGTGTGGTGG + Intronic
1096713289 12:53474214-53474236 GAAGCTTTTCTGGTGGGAGGTGG - Intronic
1097623006 12:61964505-61964527 GAGGGTCATTTGGTATAAGGTGG - Intronic
1099923675 12:88990783-88990805 GTGGCTTAGCTGGAGTATGGAGG + Intergenic
1103993348 12:124813914-124813936 GAGGCTTTGCTGGAGGAAGGGGG - Intronic
1108494952 13:51016290-51016312 GATGCTTATATGGTGGTAGGAGG - Intergenic
1108830236 13:54468663-54468685 GAGGCATATATGGAGAAAGGGGG + Intergenic
1118917660 14:70121509-70121531 GAGGCTGAAGTGGTTTAAGGAGG - Intronic
1126297493 15:47156963-47156985 GAGCCTTATCTGGAGGAAGAAGG + Intergenic
1128370206 15:67034736-67034758 GAGGCTCATCTGTTCTCAGGAGG - Intergenic
1132028869 15:98424503-98424525 GAGGCGTCTCAGCTGTAAGGTGG - Intergenic
1134667785 16:16031749-16031771 GGGGCTGATCTGGTGTACGAAGG - Intronic
1137626192 16:49910303-49910325 CAGGCAAAACTGGTGTAAGGAGG + Intergenic
1139194884 16:64907164-64907186 GAGTCTTCTCTGGAGTGAGGTGG + Intergenic
1141188588 16:81807144-81807166 GAGGCTTATCTTGTTGAACGTGG + Intronic
1145115473 17:20206215-20206237 GAGGGGCATCTGGTGTAACGTGG + Intronic
1145840954 17:27993987-27994009 GAGGCCTATGTGGTGTGACGAGG - Intergenic
1146341689 17:32024884-32024906 GAGGCTGATTTGGGGTATGGAGG - Intronic
1153337182 18:3936779-3936801 GAGGCATATATGGGGTAATGTGG + Intronic
1162793301 19:13074013-13074035 TGGGCTTACCTGGTGGAAGGAGG - Exonic
1163968065 19:20766601-20766623 GATGCTTGTCTTGTTTAAGGAGG - Intronic
1167549027 19:50146832-50146854 GAGGCTGATGTGGTGTGTGGTGG + Intergenic
925291710 2:2752339-2752361 GAGGCCAGTCTGGTGTCAGGTGG + Intergenic
927779640 2:25929027-25929049 GAGGCATGTGTGGTGGAAGGTGG + Exonic
931177747 2:59870653-59870675 GAGGCTTCTTGGGGGTAAGGAGG - Intergenic
940190909 2:151039056-151039078 AAGCCTTATCTTGTGCAAGGAGG - Intronic
940826333 2:158416604-158416626 GAGGCTGATGTGGTCTCAGGTGG - Intronic
941879393 2:170465639-170465661 GAGGCTTTTCTGCTGATAGGGGG - Intronic
942190317 2:173463053-173463075 GAGGCTTCTCTGTTGGAACGAGG - Intergenic
1169259053 20:4121916-4121938 AAGGGCTACCTGGTGTAAGGTGG + Intronic
1172952235 20:38729537-38729559 GAGGCTCCTCAGGTGTGAGGAGG + Intergenic
1173066169 20:39714485-39714507 GAGGCCAATCTGGTGTCATGGGG - Intergenic
1178488360 21:33032825-33032847 GAGGTTTAGCCGGGGTAAGGCGG + Intergenic
1182875117 22:33684958-33684980 GAGGATTTTCAGGTGTATGGGGG + Intronic
1185234809 22:49705527-49705549 AAGGCTTATCTGGATTAAGGTGG + Intergenic
949490217 3:4581778-4581800 GAGGCTTTTCTGGTGTTGGAGGG + Intronic
953070721 3:39516760-39516782 GAGGCTCATATGGTTTCAGGTGG + Intronic
963776984 3:149449832-149449854 GAGGCTTCTCTGGGGGAAAGAGG - Intergenic
965978415 3:174655286-174655308 GAGGTTTATCTAGTTTACGGTGG - Intronic
965978420 3:174655443-174655465 GAGGTTTATCTAGTTTACGGTGG - Intronic
971330449 4:25677224-25677246 CAGGCTGATCTGGGGCAAGGAGG - Exonic
983022592 4:162697462-162697484 GAGGCTTTTCTGGTCTAACGTGG + Intergenic
986601202 5:9474806-9474828 GAGGGTTGGCTGGTGTAAGCTGG - Intronic
992933868 5:81680651-81680673 GAGGCCTATCTGGAATAAGAGGG + Intronic
994272631 5:97799346-97799368 AATGGTTATCTGGAGTAAGGTGG + Intergenic
994336171 5:98568823-98568845 GAGGGTCACCTGGTGTAAAGAGG - Intergenic
997853875 5:137356130-137356152 GAGGCAGAGCAGGTGTAAGGAGG - Intronic
998628587 5:143873706-143873728 GAGGCTTAGGTGGAGTAGGGAGG - Intergenic
1002826643 6:780083-780105 GAGTGTTATCAGCTGTAAGGAGG + Intergenic
1010680570 6:78794207-78794229 CAGTCTTAACTGGTGTAAGATGG + Intergenic
1010817915 6:80381220-80381242 GAGGCCTATCTGGTATAGGACGG - Intergenic
1012391721 6:98748847-98748869 AAGGCTTATTTGGAGTATGGGGG - Intergenic
1017139556 6:151178388-151178410 CAGTCTTATCTAGTGGAAGGAGG - Intergenic
1019282536 7:207699-207721 GGGGATTGTCTGGTGTGAGGGGG - Intronic
1019471342 7:1223100-1223122 GCGGCTGATCTGGTGAAAGGAGG - Intergenic
1022399799 7:30026484-30026506 GAGGCTTTTCTTGTGGAACGCGG - Exonic
1022627229 7:32050190-32050212 GAGGCTTTTCTTGAGTTAGGTGG - Intronic
1023246273 7:38207641-38207663 AAGGCATATCTGATGTCAGGAGG + Exonic
1027192331 7:76003950-76003972 GACGCTGAGCTTGTGTAAGGGGG + Intronic
1027227089 7:76250648-76250670 GAGGATTAAGTGGGGTAAGGTGG - Intronic
1041477962 8:58286334-58286356 GAGGAGAATGTGGTGTAAGGTGG + Intergenic
1048307169 8:133292523-133292545 GAGGCCTTTCTGGAGAAAGGAGG + Intronic
1055068806 9:72146170-72146192 GAGGCAGACATGGTGTAAGGTGG + Intronic
1057414858 9:94852168-94852190 AAGGCTTCTCTGGTGTAGGCAGG - Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1189872970 X:45404136-45404158 GAGCCTTATCTGGTGAGGGGTGG - Intergenic
1190162820 X:48046145-48046167 GACGTTTATCTGCTGTAATGTGG - Intronic
1190165000 X:48066191-48066213 TAGGATTATCTGGTTTGAGGAGG - Intronic
1192161135 X:68788673-68788695 GAGGCACATCTGGGCTAAGGAGG + Intergenic
1197818941 X:130527312-130527334 GGTGCTTAACTGGGGTAAGGAGG + Intergenic