ID: 921857600

View in Genome Browser
Species Human (GRCh38)
Location 1:220003847-220003869
Sequence CACAAGGCCATTCCAGGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 278}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921857600 Original CRISPR CACAAGGCCATTCCAGGAAA AGG Intronic
903188557 1:21643233-21643255 CAGAAGGCCTTTCCAGGATCTGG + Intronic
904519619 1:31084726-31084748 CTCAAGGCCATGCTAGGCAAGGG + Intergenic
904825784 1:33272912-33272934 CAGAAGGACATTCCTGGAAGAGG - Intronic
905640675 1:39587601-39587623 CACCAGGCCACTCCAGCCAATGG + Intergenic
905654859 1:39679795-39679817 CACAATGCCAGGCCAGGAACTGG - Exonic
907377886 1:54059023-54059045 CAGAAGGGCTTTCAAGGAAAAGG - Intronic
909297552 1:73970101-73970123 CACAAGGCCATGACAGGCAAGGG - Intergenic
909325389 1:74345549-74345571 GGCAAGGCCATCCCAGGAAGAGG + Intronic
909332868 1:74435659-74435681 CACAAGGACAGTTCAAGAAAAGG - Intronic
910647775 1:89531943-89531965 TACAAGGTCATTCCAGGAAAAGG - Intronic
911006090 1:93226069-93226091 TAGAAGGGCATTCCAGGAAAAGG - Intronic
911156555 1:94642919-94642941 CAGAAGAGCATTCCAGGATAGGG - Intergenic
911287807 1:96018664-96018686 AAAAAGCCCATTCTAGGAAAAGG - Intergenic
911755010 1:101544040-101544062 CACAGGTCCACTCCAGGAAGTGG - Intergenic
917962483 1:180155521-180155543 CACAAGGCTGGCCCAGGAAACGG - Intronic
918579517 1:186109723-186109745 TACAAAGCTATTACAGGAAAAGG + Intronic
918716087 1:187788826-187788848 GGAAAGGCCATTCCAGGCAAAGG + Intergenic
918778909 1:188670970-188670992 GCCAAGGCCATGCCAGGTAATGG - Intergenic
919942046 1:202294734-202294756 CACAAGGCCATCCCAGCCCAAGG + Intronic
920361093 1:205416996-205417018 TACAAGCCCATTCCAGGACTAGG + Intronic
921857600 1:220003847-220003869 CACAAGGCCATTCCAGGAAAAGG + Intronic
922544510 1:226445874-226445896 CCTAAGGCCATGCCAGGTAAGGG + Intergenic
922916634 1:229263394-229263416 GACAAGAGCATTCCAGGAAGAGG + Intergenic
923130864 1:231073546-231073568 CAGAAGGCCAGGCCAGGCAAGGG + Intergenic
923930374 1:238688023-238688045 CACAAGGCAAATCAATGAAAAGG - Intergenic
1063211542 10:3885525-3885547 CTCAAGGACCTTCCAGGGAATGG - Intergenic
1063436204 10:6034316-6034338 GACAAGGCCTTTCAGGGAAAAGG - Intronic
1063671303 10:8102150-8102172 CATGGGGCCCTTCCAGGAAATGG - Intergenic
1066565760 10:36719997-36720019 CACCATGCCAGGCCAGGAAAGGG + Intergenic
1066995777 10:42561644-42561666 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
1067066763 10:43108368-43108390 CCTAAGGCCATGCCAGGCAAGGG - Intronic
1067857992 10:49813822-49813844 GACAAAGACATTACAGGAAAAGG - Intergenic
1068076262 10:52258950-52258972 GAAAAGGCCATTCCAGGCAAGGG + Intronic
1069863716 10:71487083-71487105 GAGAAGGCCATTCCAGGCAGGGG - Intronic
1070885002 10:79886112-79886134 AATAAGACCTTTCCAGGAAAGGG + Intergenic
1071135896 10:82454026-82454048 CACAATGCCATGCCCAGAAAGGG - Intronic
1071378787 10:85036726-85036748 CCTAAGGCCATGCCAGGTAAAGG + Intergenic
1071558035 10:86621211-86621233 CACAAAGACATTCCATCAAAAGG - Intergenic
1072499228 10:95995686-95995708 GTCGAGGCCATTCCAGGCAAAGG - Intronic
1075569151 10:123526640-123526662 CAGAAGGCAAGTCCAGGAGAGGG + Intergenic
1076424409 10:130357310-130357332 CACCTGGCCTTTACAGGAAAAGG + Intergenic
1077467222 11:2739098-2739120 CTCAAGGCCACCCCAGGACAGGG - Intronic
1077652566 11:3986648-3986670 AAGAAGAGCATTCCAGGAAAGGG + Intronic
1079240775 11:18720991-18721013 CTCCAGGCCCTTCGAGGAAAGGG - Intronic
1083153947 11:60811022-60811044 CACCAGGCCTTCCCAGGACACGG + Intergenic
1084391695 11:68881455-68881477 CACAAGGCCCTTCCTAGGAAGGG + Intergenic
1085332490 11:75665767-75665789 CTCATGGCTATTCAAGGAAAAGG + Intronic
1085509537 11:77081285-77081307 AGAAAGGCCATTCCAGGCAAAGG - Intronic
1085839286 11:79992625-79992647 CACAAAGGCATCTCAGGAAATGG + Intergenic
1085845340 11:80058798-80058820 CTCAAGGCCACACCAGTAAAGGG + Intergenic
1087262228 11:96023693-96023715 CACAAGGCCTTTCCACCTAATGG + Intronic
1087743176 11:101912924-101912946 CCTAAGGCCATGCCAGGCAAGGG + Intronic
1089174414 11:116537974-116537996 CACAAGGCCATCCCAAGCATGGG + Intergenic
1089176780 11:116554329-116554351 GACAAAGGCATTCCAGGAAGAGG + Intergenic
1090805755 11:130201156-130201178 CACATGGGCATCCCAGGAACAGG + Intronic
1091049222 11:132352555-132352577 CACAAGGGTCTTCAAGGAAAAGG + Intergenic
1091890751 12:4052335-4052357 CCCAAGGCCATTTGAGAAAATGG + Intergenic
1091910939 12:4230166-4230188 CTCATGGCCTGTCCAGGAAAAGG - Intergenic
1092906456 12:13104299-13104321 CTCAAGGCCATTCCCTGAAAAGG + Intronic
1093313446 12:17619563-17619585 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
1094231702 12:28112555-28112577 TAGAAGCCCATTCCAGGAGATGG + Intergenic
1095267104 12:40173499-40173521 AACTAAGCCATTCCAGGAGAAGG + Intergenic
1095662958 12:44759292-44759314 CACAAGGCCAGTACAGGTGATGG - Intronic
1096826975 12:54286943-54286965 CACAAGGACGTTCCTGCAAAAGG - Intronic
1096967576 12:55640512-55640534 CTTAAGGCCATGCCAGGCAAAGG - Intergenic
1097679753 12:62637763-62637785 CAGAAGGGCAGTTCAGGAAAGGG - Intergenic
1100232046 12:92618552-92618574 GACAAGGACATTTCAGGAAGAGG + Intergenic
1102821832 12:115915092-115915114 GGCAAGGGCATTCCAGGAAAGGG + Intergenic
1103257501 12:119554660-119554682 CCTAAGGCCATGCCAGGAAAGGG + Intergenic
1103472372 12:121192174-121192196 AAGAAGGGCATTCCAGGAAGAGG + Intergenic
1105558335 13:21466499-21466521 AACAAGACCATGCCAGGCAAGGG + Intergenic
1106758532 13:32845798-32845820 GACAAGGCTAATCCATGAAATGG - Intergenic
1111208153 13:85039743-85039765 CCTAAGGCCATGCCAGGCAAGGG - Intergenic
1111675300 13:91379480-91379502 CAGAAAGACATTCCAAGAAATGG - Intergenic
1112393105 13:99003089-99003111 CACAAGCCCCTTCCAGGCCAAGG + Intronic
1115100668 14:29694812-29694834 GGCAAGGGCATTCCAGGTAAGGG + Intronic
1117224191 14:53638160-53638182 CACAAAGCCCGTTCAGGAAATGG - Intergenic
1117800369 14:59437648-59437670 CTCAATTCCATTCCAGGATATGG - Intronic
1118093378 14:62508435-62508457 CATGAGGCAATTCCAGCAAAGGG + Intergenic
1118720214 14:68588599-68588621 GACAGGGGCATTCCAGGAAGAGG + Intronic
1119569543 14:75658277-75658299 CCTAAGGCCATGCCAGGCAAGGG + Intronic
1119694166 14:76699321-76699343 CCTAAGGCCATGCCAGGCAAAGG + Intergenic
1120182609 14:81360209-81360231 AACAAGGACATTACAAGAAAAGG + Intronic
1120943151 14:89968609-89968631 CAAAAGGCTAATTCAGGAAAAGG - Intronic
1121417846 14:93791199-93791221 CACAAGGCCCTGCCACCAAAAGG - Intergenic
1121556367 14:94840861-94840883 CACAAGGAGATTACAGGGAAAGG + Intergenic
1121898286 14:97669433-97669455 CACGAGGCCATTCTAGTTAAAGG + Intergenic
1122582586 14:102780437-102780459 CACAACACTATTCCAGGAAAGGG + Intronic
1123712922 15:23003396-23003418 TAAATGGCCATCCCAGGAAAAGG - Intronic
1124037456 15:26068867-26068889 GACAAGGGCATTCCAGGCAAGGG - Intergenic
1125107234 15:35986446-35986468 AACAAGGCCAGACCAGGAATAGG - Intergenic
1126710317 15:51447638-51447660 CCAAAAGCCATTCTAGGAAATGG - Intergenic
1127378422 15:58406537-58406559 CCCAAGGCCATGCCAGGGTAGGG - Intronic
1128345371 15:66849635-66849657 CACAAGGACCTTCCAGGGAGAGG - Intergenic
1128923134 15:71630246-71630268 CACATGGCTATTCCAGGGAGGGG + Intronic
1130515588 15:84623594-84623616 GATAAGGCATTTCCAGGAAATGG + Exonic
1130863550 15:87912217-87912239 GGCAAGGCCATTCAAGGCAAAGG - Intronic
1132565952 16:623071-623093 GACATGGCCATCCCAGGAAGTGG + Intronic
1133302052 16:4788318-4788340 CACCAGGCCCTGCCAGGACAAGG - Exonic
1134652406 16:15920388-15920410 CACAATGACATTACAGGAAAAGG - Intergenic
1135266416 16:21030185-21030207 CACAAGGCCTGACCAGGAAGTGG - Intronic
1137552412 16:49448116-49448138 GACAAAGCCATTACAAGAAAAGG - Intergenic
1138136435 16:54527346-54527368 CACAGGGCCATTCAAGGGGAGGG + Intergenic
1138307951 16:55995388-55995410 CTCAGGGCCAAACCAGGAAATGG - Intergenic
1138334271 16:56240266-56240288 GACAAGCACATTCCAGGGAATGG - Intronic
1138587602 16:57981053-57981075 CCTAAGGCCATGCCAGGCAAGGG - Intronic
1138746542 16:59369151-59369173 ACCAAAGCCATTTCAGGAAAGGG - Intergenic
1139330184 16:66182464-66182486 TAAAAGGCCATTGAAGGAAAGGG - Intergenic
1140972044 16:80022891-80022913 CCCAAGGCCATACAATGAAAGGG - Intergenic
1141615673 16:85208122-85208144 CACCAGGCCATTCAAGGACAAGG - Intergenic
1143996382 17:11009973-11009995 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
1144337696 17:14286639-14286661 CAGAAGGCCATGCCAGGCAAGGG - Intergenic
1144363390 17:14518432-14518454 CACAAGACAATTACAGCAAAGGG - Intergenic
1145286475 17:21509895-21509917 CCTAAGGCCATGCCAGGCAAGGG - Intergenic
1145391139 17:22456423-22456445 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
1145392232 17:22464522-22464544 CCTAAGGCCATGCCAGGCAAGGG - Intergenic
1146096822 17:29937930-29937952 CACAAAGCCATTTTAGGAAATGG + Intronic
1146626308 17:34438084-34438106 GGCAAGGGCATTCCAGGAAGAGG + Intergenic
1146945718 17:36872045-36872067 CACAATGCCCCTCAAGGAAAGGG + Intergenic
1147587275 17:41659734-41659756 GGAAAGGGCATTCCAGGAAAGGG + Intergenic
1148687389 17:49508476-49508498 CAAGAGACCATTTCAGGAAATGG + Intronic
1150236770 17:63599706-63599728 CACAAGGCCATTCTATGGTAAGG + Intergenic
1150425675 17:65075090-65075112 GTCAAGGCAATACCAGGAAAGGG - Intergenic
1152476338 17:80520899-80520921 CACAAAGCCCTACCAGGAAGAGG + Intergenic
1154130287 18:11730960-11730982 CCCAAGGCCATGCTAGGCAAGGG - Intronic
1155874996 18:31075221-31075243 CACAAGGAAATTCAAGGAGATGG + Intronic
1157182861 18:45512789-45512811 CACAAGGCCATTACTGGATTGGG + Intronic
1157253786 18:46119759-46119781 AAGAAGGGCATTCCAGGCAATGG + Intronic
1157532792 18:48436111-48436133 CTCAAGGAGCTTCCAGGAAAGGG - Intergenic
1157539467 18:48489585-48489607 GACAAGGAAATTCCAGGAGAGGG + Intergenic
1159189844 18:65027379-65027401 CCCAAGGCCATTCCAGGCAATGG + Intergenic
1160207355 18:76845876-76845898 CAGAAGGCCATCCCATGAAGAGG + Intronic
1161226888 19:3150959-3150981 AACAGGGTCACTCCAGGAAAAGG - Intronic
1163638220 19:18447414-18447436 CACAAGGCAGCTCCAGGACAGGG + Intronic
1165485194 19:36091186-36091208 CACATGGACCTGCCAGGAAAGGG - Exonic
1165610031 19:37143425-37143447 CGCAAAGCCATGCCAGGCAAGGG - Intronic
1166620281 19:44291932-44291954 GACAATGACATTCCAAGAAAAGG + Intronic
1167875936 19:52412520-52412542 CACAAGCCCATTTCAGGGATGGG - Intronic
1168252905 19:55150671-55150693 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
925019349 2:556412-556434 CCTAAGGCCATTGCAGGCAAGGG + Intergenic
926842423 2:17096894-17096916 GACAAAGACATTTCAGGAAATGG - Intergenic
928536741 2:32248474-32248496 CATAAGACCATGCCAGGCAAAGG + Intronic
928860461 2:35851099-35851121 GAAAAGAACATTCCAGGAAAAGG - Intergenic
929198065 2:39206520-39206542 CACATGGGCATTCCAGAAATGGG + Intronic
929266716 2:39926544-39926566 AACAACACCATTTCAGGAAAGGG - Intergenic
929865343 2:45712667-45712689 CAAAAGGCCCTTCCAGGCAAAGG - Intronic
930283821 2:49403381-49403403 CACAAGCCCATTGCAATAAAAGG + Intergenic
930314567 2:49781896-49781918 CACCAGGCCATTCAAGACAAAGG + Intergenic
933035730 2:77395063-77395085 CCAAAGGCCATGCCAGGCAAGGG - Intronic
935830767 2:106998832-106998854 AAGGAGGCCATTCCAGAAAAAGG - Intergenic
939045339 2:137243372-137243394 CAAAAGGCAAATCCAAGAAAAGG + Intronic
939321712 2:140631100-140631122 GACAAGGACATTAGAGGAAATGG + Intronic
939424585 2:142018263-142018285 GGCATGGCCATTCCAGGAAAAGG - Intronic
942297951 2:174535384-174535406 CACCAGGCCAGTCCAGGAGGAGG + Intergenic
942795910 2:179819184-179819206 CACAGGGCCAGAGCAGGAAAGGG - Intronic
944417695 2:199495372-199495394 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
945964295 2:216169633-216169655 CCTAAGGCCATGCCAGGCAAGGG - Intronic
946400865 2:219467856-219467878 CAAAGGGCCTTTCCAGGAGAGGG + Intronic
946564799 2:220952493-220952515 CACAAGGCCATTCTACGAGAGGG + Intergenic
947370863 2:229444270-229444292 CACTAGTCCATGCCAGGAAATGG + Intronic
948933078 2:241144693-241144715 CACGAGGCCCTTCCAAGACAAGG + Intronic
1169811248 20:9611350-9611372 CAAACTGCCATTCCAGGAAGGGG + Intronic
1173997772 20:47352693-47352715 CCCAAGGCCATGCCAGGGCAAGG + Intronic
1174312490 20:49668777-49668799 CACAAGGCAATTCAGGGACAGGG - Intronic
1175330529 20:58160871-58160893 CCCAGGGCCATGCCAGGGAAAGG + Exonic
1183037304 22:35150035-35150057 CCCAGTGCAATTCCAGGAAAGGG - Intergenic
1184254227 22:43278040-43278062 CTCAAGGCCAGGCCAGGAGAGGG + Intronic
1184374679 22:44104138-44104160 CAACTGGCCCTTCCAGGAAATGG - Intronic
1184491952 22:44814915-44814937 CACAAGGCCAGCCCAGGTCATGG + Intronic
1184882848 22:47322264-47322286 CAGATGGGCATTCCAGGAAGAGG - Intergenic
949116750 3:335592-335614 CACCAGGCCAGTCCTGTAAACGG + Intronic
951092338 3:18588721-18588743 CACAAGCCCTTCCCATGAAAGGG + Intergenic
951622394 3:24617217-24617239 CACAAAGGCAATTCAGGAAAGGG + Intergenic
952026509 3:29088805-29088827 CATAAAGCCATTCGAGGAGAAGG - Intergenic
955028747 3:55196143-55196165 AGGAAGGGCATTCCAGGAAAAGG - Intergenic
955756068 3:62226278-62226300 CAAAAAGACACTCCAGGAAAAGG + Intronic
956049135 3:65228792-65228814 CAGAAGGACATTACAGCAAAGGG + Intergenic
956373987 3:68594540-68594562 CACAGGGACATTCCAGGCAAAGG - Intergenic
958733094 3:97979429-97979451 CCTAAGGCCATTCCACGCAAGGG - Intergenic
958952953 3:100436179-100436201 CCTAAGGCCATGCCAGGCAAGGG - Intronic
959071834 3:101709104-101709126 CCCAAGGCCATGCCAGGTAAGGG + Intergenic
959488960 3:106963925-106963947 CTCTAGGCCATTCCATGAAAAGG + Intergenic
959804161 3:110530921-110530943 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
961485671 3:127213857-127213879 CACCAGGCCAGTGGAGGAAAAGG - Intergenic
961744420 3:129054985-129055007 CCTAAGGCCATGCCAGGCAAGGG - Intergenic
961907456 3:130277200-130277222 CAAAAAGACATTCCAGGTAAAGG - Intergenic
962177329 3:133167977-133167999 CGTAAGGCCATGACAGGAAAGGG - Intronic
962349850 3:134648738-134648760 CAGAAGGCCCTTCCAGCAGAAGG + Intronic
962901212 3:139763484-139763506 CAAAAAGCCATTCCAGGCTAGGG - Intergenic
963578356 3:147092454-147092476 CTCAGGGCAATTCCATGAAAAGG + Intergenic
965798574 3:172467517-172467539 CACACAGCCATTCCAGGCAGTGG - Intergenic
966205458 3:177401374-177401396 TACAAGGCCATTGCAGTACATGG - Intergenic
969085387 4:4652465-4652487 ACCAAGGCCCCTCCAGGAAAAGG + Intergenic
970852136 4:20615219-20615241 CACCAGTCCTTTCCTGGAAATGG + Intronic
971389364 4:26171821-26171843 CACAAGGCCACCACAGCAAAAGG + Intronic
971618296 4:28822805-28822827 CATAAAGCCATTCAAGGACAGGG + Intergenic
972745984 4:41933392-41933414 CCTAAGGCCATGCCAGGCAAGGG - Intergenic
973047192 4:45549373-45549395 CACAATGCAATGCTAGGAAAAGG - Intergenic
973837043 4:54819950-54819972 GACATGGCCTTTCCAGGACATGG - Intergenic
976345473 4:83994538-83994560 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
977139371 4:93348569-93348591 AAGGAGGCCATTCCAGGAGATGG - Intronic
977586340 4:98779385-98779407 TAGAAGGACATTCTAGGAAAAGG + Intergenic
977817342 4:101430193-101430215 CCTAAGGCCATTCCAGGCAAGGG - Intronic
978317634 4:107457339-107457361 TAGAAGGACATTACAGGAAAAGG - Intergenic
978758821 4:112332984-112333006 CAAAAGCCCCTTCCATGAAATGG - Intronic
980032199 4:127844389-127844411 AATAAGGTCTTTCCAGGAAAAGG - Intergenic
980118967 4:128708300-128708322 CACTAAGCCATTCCATTAAAGGG - Intergenic
982166072 4:152614589-152614611 CAAAAGGCCCTTCAAGAAAATGG - Intergenic
983127607 4:163973541-163973563 CACATAGCCATGCCCGGAAACGG + Intronic
983192107 4:164765708-164765730 CACAAGGCCTTTGAAGGCAAGGG + Intergenic
983691917 4:170481323-170481345 CCTAAGGCCATGCAAGGAAAGGG - Intergenic
984606054 4:181787275-181787297 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
985651075 5:1107873-1107895 CACGAGGCCACACCAGGAGAGGG + Intronic
986047427 5:4052896-4052918 CTTAAGGCCATGCCAGGCAAGGG + Intergenic
986207238 5:5636392-5636414 CCCAAGGCCATGCCAGGCAAGGG - Intergenic
986316753 5:6594255-6594277 CCCAAGGCCATGCCAGGCAAGGG + Intergenic
986471805 5:8083511-8083533 CCTGAGGCCATACCAGGAAAGGG - Intergenic
986767595 5:10941637-10941659 CCCAAGGCCATTCCAGGCAAGGG + Intergenic
987096844 5:14557810-14557832 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
987862609 5:23506767-23506789 CAGAGGGCCAGTCCAGAAAAGGG + Intergenic
988992717 5:36687119-36687141 CAGGAGGCCATTCCAGGAGTGGG + Exonic
989626330 5:43432568-43432590 CCCCAGGCCAATCCTGGAAAGGG - Intergenic
990617727 5:57524309-57524331 CACAAGGTCATCCAGGGAAAAGG - Intergenic
992767026 5:80010818-80010840 CTGCAAGCCATTCCAGGAAAGGG + Intronic
994677922 5:102848371-102848393 CACATGGCCCTTACATGAAAGGG + Intronic
996350872 5:122540046-122540068 CATAAGGTCAGTTCAGGAAAGGG + Intergenic
996424944 5:123304456-123304478 CTTAAGGCCATGCCAGGCAAGGG - Intergenic
996474395 5:123899920-123899942 AACATTGCCATCCCAGGAAATGG - Intergenic
997400026 5:133595161-133595183 CTCAAAGCCATTCTAGGAAGGGG + Intronic
997659677 5:135579511-135579533 CACAAGGCCAGTTCTGGACAGGG + Intergenic
999845849 5:155479376-155479398 CACAAGGCCGTTCCAGAGAAAGG - Intergenic
1000042872 5:157498163-157498185 CACAGGGTCCTTCCAGGAGAAGG + Intronic
1000588342 5:163127687-163127709 CACATGCCCAGTCCTGGAAAAGG + Intergenic
1000997431 5:167973678-167973700 CAAAAGGGCATTCCAGGCAAAGG + Intronic
1001534366 5:172488435-172488457 CACGAGGCCATGCCTGGAGATGG - Intergenic
1003703228 6:8494226-8494248 CACAAGGTCACTCAAGGACAGGG - Intergenic
1004423559 6:15492541-15492563 GACAAGTCCAGGCCAGGAAAAGG + Intronic
1004435476 6:15588806-15588828 AACAAAGACATTCCAGGAAGAGG - Intronic
1004695509 6:18029270-18029292 ACCAAGGCCATTCCTGGAGAAGG + Intergenic
1006420890 6:33933275-33933297 CCTAAGGCCATGCCAGGCAAGGG + Intergenic
1006575389 6:35041558-35041580 CACAGGGCCTTTCCTGGAATAGG + Intronic
1006903200 6:37516246-37516268 CAGAAGGCCCTTTCAGCAAAGGG + Intergenic
1007848279 6:44779294-44779316 CAGAAGGCCACTCCAGGGCAAGG - Intergenic
1009302783 6:62047746-62047768 CACAGGGTGATCCCAGGAAATGG + Intronic
1010927059 6:81755535-81755557 CCCATGGCCATTCCCAGAAATGG + Intergenic
1012643478 6:101651641-101651663 CAGAAGAACATTCCAGGCAAAGG + Intronic
1013398103 6:109763715-109763737 CTCAAAGACAGTCCAGGAAAGGG - Intronic
1014258281 6:119186203-119186225 CCCAAGGACTTTCCAGCAAAGGG - Intronic
1016035250 6:139377020-139377042 CACAAAGGCATTGAAGGAAAGGG + Intergenic
1016661337 6:146584688-146584710 CCTAAGGCCATACCAGGCAAGGG + Intergenic
1017196516 6:151706468-151706490 CACAAGGCCATCCCAGGGCGGGG + Intronic
1017197543 6:151717588-151717610 CATAAAGCTAATCCAGGAAAAGG + Intronic
1019019579 6:168906865-168906887 CCTAAGGCAATGCCAGGAAAGGG - Intergenic
1022804407 7:33807424-33807446 CAGAAGCCCATTCCAGGAACAGG - Intergenic
1023067597 7:36393936-36393958 CCTAAGGCCATGCCAGGCAAGGG - Intronic
1024566498 7:50685803-50685825 TACCAGGCGATTCCAAGAAATGG + Intronic
1024675396 7:51633635-51633657 CCTAAGGCCATGCCAGGCAAGGG - Intergenic
1027760601 7:82274154-82274176 GAAAATGCCATTCTAGGAAAAGG - Intronic
1028585701 7:92448899-92448921 CACAACGTCATTACAGTAAAAGG - Intronic
1031680473 7:124667279-124667301 CACAATGCCAACCCAGAAAATGG - Intergenic
1031881924 7:127207848-127207870 CCTAAGGCCATGCCAGGCAAGGG + Intronic
1032345844 7:131115771-131115793 CAAAAGAGTATTCCAGGAAAAGG - Intronic
1032358257 7:131230123-131230145 CCCAAGGCCATGCCAGGCAAGGG - Intronic
1032420376 7:131774565-131774587 AACAAGGGCAGCCCAGGAAAGGG - Intergenic
1032578375 7:133080103-133080125 CGCAAGGGCATTCCAGGTGAAGG + Intronic
1033271757 7:139938438-139938460 CACAAGGACATGAGAGGAAAGGG + Intronic
1034212906 7:149380873-149380895 CACATGGTCCTTCCAGAAAATGG - Intergenic
1035191502 7:157173055-157173077 CATAAGACCAGTCCAGGAAAAGG + Intronic
1036669357 8:10770773-10770795 CAACATGCCAGTCCAGGAAATGG + Intronic
1037654310 8:20869888-20869910 CACAAGGCATTTCCTGGAGAGGG + Intergenic
1038325514 8:26569818-26569840 CAAAGGGCCATTGCAGGGAAAGG + Intronic
1039362101 8:36887821-36887843 CTTAAGGCCATTCTAGGCAAGGG - Intronic
1039551436 8:38446084-38446106 CAGGAGAGCATTCCAGGAAAAGG + Intronic
1039759488 8:40558958-40558980 CCTAAGGCCATGCCAGAAAAGGG + Intronic
1040829916 8:51664918-51664940 GGCAAGGGCATTCCAGGAAGAGG - Intronic
1044545275 8:93452186-93452208 TATAAGCCCATTCTAGGAAATGG + Intergenic
1044707333 8:95021295-95021317 CACAAGGACAATCCAGAAAGAGG + Intronic
1045040248 8:98216876-98216898 CAAAAGGTCCTTCCAAGAAAAGG + Intronic
1045695966 8:104809264-104809286 AACAATGGCATTCAAGGAAAGGG - Intronic
1048150263 8:131886990-131887012 CACAAGGCCATTTCAGCTGATGG + Intergenic
1048375327 8:133818072-133818094 CAGGAGGCCTTTCCAGGAAGAGG - Intergenic
1048800097 8:138187150-138187172 CACAATACCATACAAGGAAAGGG - Intronic
1051022058 9:12556524-12556546 CCTAAGGCCATGCCAGGCAAGGG - Intergenic
1053027484 9:34741777-34741799 CACAAGGACAGTCAACGAAAAGG - Intergenic
1055230930 9:74064448-74064470 CAAGAAGGCATTCCAGGAAAAGG + Intergenic
1055997426 9:82175356-82175378 CAGTAGGCAATTCCAGGAATTGG - Intergenic
1057097809 9:92327868-92327890 CCTAAGGCCATGCCAGGCAAGGG - Intronic
1057499556 9:95585825-95585847 CACAGGGCCATTTGAGGAGATGG - Intergenic
1058363573 9:104179981-104180003 AACAAGGACATTCCAGGATCAGG + Intergenic
1058527393 9:105873681-105873703 GTCAAGGGCATTCCAGGTAAAGG + Intergenic
1060102500 9:120852774-120852796 CAGAAGGGCATTCCAGGCAGAGG - Intergenic
1060208662 9:121697706-121697728 CAGAAGGCCATCCCAGGCAGTGG - Intronic
1061154165 9:128847072-128847094 CCCAAGGCCCCTCCAGGACAGGG - Intronic
1061773597 9:132945798-132945820 GAGAAGGCCATTCCAGGCAGAGG + Intronic
1061781647 9:132999775-132999797 CCCCAGGACCTTCCAGGAAAGGG - Intergenic
1062566018 9:137164310-137164332 CACAAGGACATAGCAGGAAAGGG - Intronic
1185783841 X:2872718-2872740 CAAAAAACCATTCCTGGAAATGG - Intronic
1186780900 X:12911089-12911111 CTCAAGGGCATGCCAGGCAAAGG + Intronic
1186920063 X:14269015-14269037 TAAATGGCCATTCCAGTAAAAGG - Intergenic
1188481755 X:30643294-30643316 CACAAAACCCTTCCATGAAATGG + Intergenic
1190410251 X:50130065-50130087 CCTAAGGCCATGCCAGGCAAGGG - Intergenic
1190628154 X:52356813-52356835 AACAATTCCATACCAGGAAAGGG - Intergenic
1192357057 X:70413880-70413902 CAGAAGAACATTTCAGGAAAAGG + Intronic
1192709599 X:73566088-73566110 CACAGGGCAATTCAAGGAGAAGG - Intronic
1193617667 X:83710201-83710223 CTCAAGGCCCTTCCCGGTAAAGG - Intergenic
1194640607 X:96399514-96399536 AACAAGAGCATTCCAGGAAGAGG - Intergenic
1194766815 X:97851469-97851491 GAGGAGACCATTCCAGGAAAAGG - Intergenic
1195240575 X:102947769-102947791 CCTAAGGCCATGCCAGGCAAGGG - Intergenic
1195429654 X:104774307-104774329 GAGAAGGCCATTGCAGGCAAAGG + Intronic
1196911849 X:120491861-120491883 CCTAAGGCCATGCCAGGCAAGGG + Intergenic