ID: 921859172

View in Genome Browser
Species Human (GRCh38)
Location 1:220023068-220023090
Sequence AAGAGTATCCTGCTTCTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921859172_921859176 19 Left 921859172 1:220023068-220023090 CCAATGAGAAGCAGGATACTCTT 0: 1
1: 0
2: 2
3: 8
4: 118
Right 921859176 1:220023110-220023132 GTGATAGAAAACAGTGACACAGG 0: 1
1: 0
2: 4
3: 16
4: 245
921859172_921859174 -3 Left 921859172 1:220023068-220023090 CCAATGAGAAGCAGGATACTCTT 0: 1
1: 0
2: 2
3: 8
4: 118
Right 921859174 1:220023088-220023110 CTTGGATCCAAGAAAATAAGAGG 0: 1
1: 0
2: 0
3: 19
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921859172 Original CRISPR AAGAGTATCCTGCTTCTCAT TGG (reversed) Intronic
901905124 1:12401955-12401977 AATAGTATACTGCTTCCCAAAGG - Intronic
902437046 1:16405023-16405045 AAGAATATCCTGCTCCTAATGGG - Exonic
903324246 1:22560763-22560785 AAGAGTTTCTTCCTTCCCATTGG + Intergenic
907884863 1:58583591-58583613 AAGAGTTACCTGCTTCTTCTAGG - Intergenic
908832030 1:68188940-68188962 AAGAGTCTCCTCCTTATCAGAGG + Intronic
911798176 1:102100097-102100119 CAGAGTAGGCTGATTCTCATGGG + Intergenic
913375844 1:118151436-118151458 AAAATTATTCTGCTTCTCAGTGG - Intronic
915053320 1:153101364-153101386 AGGAGTATCCTGCTGCTGTTGGG - Intronic
915430537 1:155862936-155862958 AAGAGTCTCTTGCTTCTAATAGG - Intronic
916034443 1:160909076-160909098 AAGAGTAATGTGCTTATCATGGG - Intergenic
918492794 1:185099910-185099932 AATGGTATACTGCTTCTCACTGG - Exonic
918634707 1:186761646-186761668 TGCAGTATCCTGCCTCTCATAGG + Intergenic
920946336 1:210532685-210532707 AAGAGTATCCTGCATATGGTAGG - Intronic
921859172 1:220023068-220023090 AAGAGTATCCTGCTTCTCATTGG - Intronic
922942363 1:229478615-229478637 AAGAGTCTGCTGCTTTTTATGGG - Intronic
1063571515 10:7218882-7218904 AAGAGTGTCCTGATTTTTATAGG - Intronic
1065419994 10:25532510-25532532 AAGATTCTCTTGCTTCTCCTTGG + Intronic
1066474510 10:35731926-35731948 AAGGTGATCCTGCTTCTCAGGGG + Intergenic
1066518270 10:36188013-36188035 AAGAGTATCCTGCATTTCGAAGG + Intergenic
1067664070 10:48258237-48258259 AAGACTATCCTGCCTCTGCTAGG + Intronic
1071241939 10:83716923-83716945 AAGATTATAATGCTTCTCTTTGG - Intergenic
1071952871 10:90724717-90724739 AAGAGTATCCAGACTCTGATTGG + Intergenic
1074108651 10:110407404-110407426 AAGAGTATCCTGTGGCTCAGAGG - Intergenic
1076670733 10:132119659-132119681 AAGAGTAACCTGCCTCTTCTTGG + Intronic
1079655788 11:22985095-22985117 AATAGTAGTCTGATTCTCATAGG - Intergenic
1080397169 11:31900900-31900922 AAGAGTGTCTTGATTCTCAAGGG - Intronic
1082081158 11:48013539-48013561 AGGAGAATCTTGCTTCTCATGGG + Intronic
1084685263 11:70690401-70690423 ATTAGTACCCTTCTTCTCATAGG + Intronic
1086056084 11:82648340-82648362 AAGAGTATCATCCTTCAAATGGG - Intergenic
1086877840 11:92119049-92119071 TAGAGTATCCAACCTCTCATGGG - Intergenic
1087455608 11:98382427-98382449 TAAATTATCCTGATTCTCATGGG - Intergenic
1088709770 11:112497808-112497830 AATAGTGTCCTCCTTTTCATGGG + Intergenic
1089835601 11:121367625-121367647 AACAGTTACCTCCTTCTCATTGG - Intergenic
1090296862 11:125595944-125595966 AAGTGTGTCCTGCTTCTCATAGG - Exonic
1096216629 12:49801369-49801391 AATAGCCTCCTGCTTCTCCTGGG + Intronic
1096544655 12:52329284-52329306 TAGAGTCTCCTGCATCTGATGGG - Intergenic
1096566514 12:52486471-52486493 AAAAATGTCCTCCTTCTCATAGG - Intergenic
1101264561 12:103070094-103070116 AATTCTATACTGCTTCTCATGGG + Intergenic
1104070132 12:125337436-125337458 CAGTGTTTCCTGCTTCTCACTGG + Intronic
1107277051 13:38689197-38689219 GAGAAGTTCCTGCTTCTCATGGG - Exonic
1108589033 13:51895870-51895892 AAGAGCATCCTGAGTCTCAGGGG - Intergenic
1108747748 13:53412283-53412305 AAGAGTTTCCTGGTACTCAAAGG + Intergenic
1121573683 14:94966393-94966415 AACAGCATGCTGCTTCTCCTGGG + Intergenic
1124085157 15:26542656-26542678 AAGAGTATTCTTCTTTTAATTGG - Intergenic
1127823612 15:62683394-62683416 TAGCGAATCCTGCCTCTCATTGG + Intronic
1131726161 15:95227567-95227589 GAGAGGATGCTGCTTCTCTTTGG - Intergenic
1135701452 16:24636296-24636318 AAGAGTGTCTGGCTTATCATAGG - Intergenic
1141291869 16:82725421-82725443 AAGGGTATCCTGCTGCTAAGTGG - Intronic
1149600207 17:57888627-57888649 AAGAGTATGCAGCTTCGCCTGGG + Intronic
1154288847 18:13086793-13086815 AAAAGTATCTGGCTTCTGATAGG - Intronic
1160670134 19:358268-358290 GAGAGTACCCTGTTTCTCATGGG - Intergenic
1164963109 19:32453613-32453635 AAGAGTCTCCTGCTTGTGTTGGG + Intronic
1165131665 19:33636302-33636324 ACAAGTATTCTGCTTCTCTTAGG + Intronic
1165148045 19:33744528-33744550 AAGAGTATCCAGCTTCTGAAGGG - Intronic
1166257834 19:41619011-41619033 AAGAGGACCCTTCCTCTCATTGG - Exonic
927678694 2:25125566-25125588 CAGGGTATCCTGTTTCTCCTAGG + Intronic
927960035 2:27235395-27235417 AAGAATATCCTGCTGACCATTGG + Exonic
932298385 2:70645516-70645538 AAGAGCATCCTGCACCTCAGAGG + Intronic
933758105 2:85656400-85656422 AAGAGAAGCCTGCCTCTCACAGG - Intergenic
935143230 2:100374614-100374636 AAGAGTATGGTGCTTCTTTTTGG + Intergenic
936418625 2:112343413-112343435 CAGGGTATCCTGATTCTCCTGGG + Intergenic
939052403 2:137323356-137323378 ATGAATATCAAGCTTCTCATGGG - Intronic
941447334 2:165618136-165618158 AAGAGCTTCTTGCTTCTCACAGG - Intronic
942194509 2:173504249-173504271 AAGTGTTTGATGCTTCTCATTGG + Intergenic
946116926 2:217471171-217471193 AAGATTGTGTTGCTTCTCATTGG + Intronic
1175693350 20:61082377-61082399 AAGAGTAGCCAGCTTCTGCTAGG - Intergenic
1182177535 22:28306531-28306553 AAGAGTCTCCAGCTTCTGGTGGG - Exonic
951821390 3:26816827-26816849 AAGAGTATCTTGCGACCCATGGG + Intergenic
952123405 3:30271556-30271578 AGGAGTGTCCTGTTTCTCTTTGG - Intergenic
952146536 3:30539053-30539075 TAGTGTTTCCTTCTTCTCATTGG + Intergenic
959913057 3:111786675-111786697 AAGATTCTACTGCTTATCATTGG - Intronic
960924845 3:122784234-122784256 AATAGTATTCTGTTTTTCATGGG + Intronic
964233156 3:154494052-154494074 AAAAGAATACTCCTTCTCATAGG + Intergenic
967588520 3:191244242-191244264 AAGAAAATCCTGTTTCACATAGG + Intronic
967697138 3:192545101-192545123 TAGAGAGTGCTGCTTCTCATAGG - Intronic
969960966 4:10944512-10944534 AACAGTTTGCTGCTTCCCATAGG + Intergenic
972223011 4:36977751-36977773 AATAATATCATGTTTCTCATTGG + Intergenic
974041784 4:56863867-56863889 AATAGCATCCTGCTTCTTTTGGG + Intergenic
976638490 4:87312105-87312127 AAGGGTATCCTGCCACTCTTGGG - Intronic
976688979 4:87847543-87847565 AAGAGCATTCTTTTTCTCATAGG - Intergenic
976814888 4:89136742-89136764 AAGAGTATCCTGCTAGTCACAGG + Intergenic
982160103 4:152560326-152560348 AAGAGTATCTTGCCTATCTTGGG + Intergenic
984043823 4:174772276-174772298 AAGAGCTTTCTGCTTCTTATTGG - Intronic
984414956 4:179446320-179446342 AAGAAGGTCCTGCTTCTCCTTGG + Intergenic
990667422 5:58089129-58089151 AAGAGTTTCCTGCTTCTCAAAGG - Intergenic
994286501 5:97975041-97975063 AAGAGTTCCCTGCTTCTTAAAGG + Intergenic
995382284 5:111548520-111548542 AAGAGTGTCCTCCTTCTGGTAGG - Intergenic
996110785 5:119564036-119564058 AGGAGACTCCTGCTTCTGATTGG + Intronic
999459815 5:151748305-151748327 AGGAGGGTCCTGCTTCTCACAGG + Intronic
999812682 5:155142767-155142789 AAGAGTTTCCTGCCTATAATTGG - Intergenic
999850494 5:155532687-155532709 AAGACTTTCCTGCTTTTCAAAGG + Intergenic
1000627651 5:163557667-163557689 AATAGAATCCTTCTTTTCATGGG + Intergenic
1000755811 5:165158169-165158191 AACAGTGTCCTTCTTCTTATGGG - Intergenic
1001080511 5:168663949-168663971 TAAACCATCCTGCTTCTCATGGG - Intronic
1001717280 5:173826532-173826554 AAGGGTAACCAGCTTCTCTTTGG - Intergenic
1002493094 5:179593557-179593579 TAGTGTGTCCTGCTTCTCGTGGG - Exonic
1008589381 6:52977799-52977821 AACCGAATCCTGCTTCTCACAGG - Intergenic
1008595408 6:53036825-53036847 AAGAATATCATTCTTCTCACTGG + Intronic
1009538922 6:64925926-64925948 ATGATTATTCTGCTCCTCATTGG - Intronic
1009866568 6:69405510-69405532 AAGAGTCTGCTATTTCTCATAGG + Intergenic
1011152871 6:84293834-84293856 AAGAGAATCATGGTTCTCAGGGG - Intergenic
1016087658 6:139934261-139934283 AAGAGTATCATGGTTATCATAGG + Intergenic
1016113098 6:140250497-140250519 TAGAGTATTCTACTTCTGATTGG - Intergenic
1017198829 6:151730443-151730465 ATGTGTGTCCTGCTTCTCAGAGG + Intronic
1018572387 6:165225049-165225071 AAGAATTCCCTGTTTCTCATGGG + Intergenic
1019051849 6:169189686-169189708 GACAATATTCTGCTTCTCATGGG + Intergenic
1021441925 7:20686766-20686788 TAGAGTTTCCTTCTTCTCCTTGG + Intronic
1022897291 7:34763844-34763866 AATAATATCCTGCTAGTCATGGG - Intronic
1028198316 7:87933061-87933083 AAGAGCATCCTGATCATCATGGG + Intergenic
1029863250 7:103598141-103598163 AAGACTATACTGCTACTGATAGG + Intronic
1030900955 7:115122654-115122676 AAGTGTCTCCTGATACTCATAGG + Intergenic
1031663064 7:124451360-124451382 AAGAGTATGTTTCTTCTCTTTGG - Intergenic
1031950627 7:127888149-127888171 AAGTGTGTCCTTCTTTTCATGGG - Intronic
1033860252 7:145615595-145615617 AAGGGTGGCCTGCTTCTCTTAGG - Intergenic
1035766570 8:2110887-2110909 AAGTGTGTCATGATTCTCATGGG - Intronic
1036073500 8:5468797-5468819 CAGAGTTTCCTGCTTCTTAAAGG - Intergenic
1038192508 8:25336188-25336210 CAGAGTATCCTGTTGCTCATTGG + Intronic
1040731699 8:50455163-50455185 AAAAGCATCCTGGTTCTAATAGG + Intronic
1043489928 8:80739224-80739246 AAGACTATCGTGGTTCTCCTGGG - Intronic
1045937430 8:107697147-107697169 GAGAGTATCCTGGAGCTCATGGG - Intergenic
1047949309 8:129916721-129916743 AATAGTACACTGCTACTCATTGG + Intronic
1050080755 9:1913285-1913307 TAGAACATCCTGCTTATCATTGG - Intergenic
1052881589 9:33603997-33604019 AACAGGATTCTGCTGCTCATTGG - Intergenic
1053856555 9:42344461-42344483 AGGAGTTTCCTCCTTCCCATGGG + Intergenic
1055160265 9:73118077-73118099 AATATTTTCCTGCTTCTCTTTGG - Intergenic
1061187555 9:129063560-129063582 AAGAGTAACCAGCTTTTCTTCGG + Exonic
1188328479 X:28837594-28837616 AAGCCTCTCCTGCTTCTCCTGGG - Intronic
1198880501 X:141275984-141276006 AAGAATAGCCTGCTTGTCACTGG + Intergenic
1198992585 X:142532350-142532372 AACAGTGTCCAGCATCTCATTGG + Intergenic