ID: 921859692

View in Genome Browser
Species Human (GRCh38)
Location 1:220029100-220029122
Sequence TGGCCACTGCCAAAAAAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921859692 Original CRISPR TGGCCACTGCCAAAAAAAGG TGG Intronic
902688429 1:18094342-18094364 AGGCCACTGACAAACAAGGGAGG - Intergenic
905001131 1:34671102-34671124 CGGCCACTGCCAACAGAGGGAGG - Intergenic
905542766 1:38773524-38773546 TGGGCACAGCCAAAAGAAAGAGG + Intergenic
906749346 1:48245197-48245219 AGGCAACTGCCAAGAGAAGGAGG + Intronic
910449374 1:87330635-87330657 TGGCTGCTGCAAAAAAAACGAGG - Intronic
913314875 1:117541116-117541138 TGGACAGTGCCGAAAAAAGCTGG - Intergenic
915819625 1:159008355-159008377 TGGCCACTGCCACAAAGTGGGGG + Intronic
919336493 1:196243484-196243506 TGGCCACTGCCAAAAGATAGGGG - Intronic
920961763 1:210670074-210670096 TGGTCACTAACAAAAAAAGTTGG - Intronic
921297098 1:213714664-213714686 TGACCAATGCCAAAACAAGGAGG + Intergenic
921848818 1:219912402-219912424 TGGCCAATGCTAAAATAATGTGG + Intronic
921859692 1:220029100-220029122 TGGCCACTGCCAAAAAAAGGTGG + Intronic
922277819 1:224095592-224095614 TGGCTGTTGCCTAAAAAAGGGGG - Intergenic
922417582 1:225435726-225435748 AGGCCACTCTCAAAAGAAGGGGG - Intergenic
923273696 1:232379190-232379212 TGGCCACTGCATAAAGAGGGAGG - Intergenic
1062773915 10:129347-129369 TTGCCATTGCCACAAATAGGTGG + Intergenic
1065069439 10:22007032-22007054 TGCCCATTAACAAAAAAAGGGGG - Intergenic
1067163903 10:43849657-43849679 TGGGCTCTGCAAAATAAAGGTGG - Intergenic
1067589203 10:47495013-47495035 TGGCCACTGCCAAACCAACAAGG + Intergenic
1070307921 10:75250905-75250927 TGGCCACTGCCCAAAGGCGGTGG - Intergenic
1070343758 10:75522291-75522313 AGGCCACTGCCAAACACAGATGG + Intronic
1073929760 10:108561790-108561812 TGACCTCTGCTAAAAAAAGTAGG - Intergenic
1075055820 10:119217683-119217705 TTGCCTCTGCCAAGGAAAGGAGG - Intronic
1079612605 11:22451898-22451920 TACCCCCCGCCAAAAAAAGGAGG + Intergenic
1080032668 11:27678316-27678338 TGGCCATGGCCAAACATAGGAGG + Intronic
1080823675 11:35830142-35830164 TGGCCACTGCCACAAGCTGGGGG - Intergenic
1081710148 11:45211053-45211075 TGGCCACTGCCAGGAAAAGGAGG - Intronic
1082093678 11:48109662-48109684 TTGTCAGGGCCAAAAAAAGGGGG - Intronic
1083242603 11:61400237-61400259 TGGCCACTACCAAGGAAATGAGG - Intergenic
1085148695 11:74229295-74229317 CAGCCACTCCCAAAAGAAGGGGG + Intronic
1089610544 11:119666318-119666340 TGGACACAGCCAAAATGAGGAGG + Intronic
1091051109 11:132373557-132373579 TGGCCACTGCCAGGAGATGGGGG - Intergenic
1092679322 12:10960363-10960385 TGGCCTCTGCCAAAACCAGATGG + Intronic
1092963027 12:13614430-13614452 TGGCCCCTGCAAAAAATATGGGG + Intronic
1093539834 12:20268369-20268391 TGGACAGTGGGAAAAAAAGGCGG + Intergenic
1102030162 12:109735704-109735726 TGACCACTTCCAAAAAAAACTGG + Intronic
1104420083 12:128627831-128627853 TGGTCAGTGCCATGAAAAGGAGG + Intronic
1106208022 13:27617544-27617566 TGGCCACCATCAAAGAAAGGAGG - Intronic
1109708181 13:66127317-66127339 TGGCCACTTCACAGAAAAGGAGG - Intergenic
1111888757 13:94055321-94055343 TGGTCACTAGCAAAGAAAGGAGG + Intronic
1112900890 13:104355372-104355394 TGGCAAGGTCCAAAAAAAGGAGG - Intergenic
1115918233 14:38341978-38342000 TGGCCACTGCCAAGGAAAGGGGG - Intergenic
1116446923 14:45021603-45021625 TGGCTACTGCCAAAAGAACCCGG - Intronic
1117073522 14:52077736-52077758 TTTCCACTGCCAAAGTAAGGTGG + Intergenic
1117967727 14:61222883-61222905 TGGCCACTGGGAATAAAATGTGG - Intronic
1118673818 14:68160813-68160835 TGGCCACTTACAAACAATGGTGG + Intronic
1122190210 14:100036284-100036306 TCCCTACTGCCAAAAAAAGTTGG + Intronic
1122878392 14:104679138-104679160 GGGCCACTGCCAGCAAACGGAGG - Intergenic
1124054676 15:26231436-26231458 TCTCCACTGCCAGAAAAAAGGGG - Intergenic
1127775014 15:62257686-62257708 TGGCCATAGCCAAAACAACGAGG - Intergenic
1129391414 15:75222834-75222856 TGGCCACTGCCAGAAACTGCAGG - Intergenic
1130607028 15:85327181-85327203 TGGGCATTGGGAAAAAAAGGGGG - Intergenic
1136531487 16:30872656-30872678 TGGCCACTACCCAAAACATGCGG - Intronic
1138926015 16:61592323-61592345 TGGTCCCTACCAAAACAAGGAGG - Intergenic
1139274850 16:65718134-65718156 TGGCCACAGCCAAAATCATGTGG + Intergenic
1139582218 16:67880402-67880424 AGGCCACAGCCAAGAAGAGGAGG - Intronic
1141542451 16:84736411-84736433 TTGCCACTGGCAAGATAAGGTGG + Intronic
1147437144 17:40423516-40423538 TGGCCCCTGTCAAAGAAATGTGG + Intergenic
1147508050 17:41039892-41039914 TGGCCAGTGCCAAGAACAGTGGG + Intergenic
1150208324 17:63426357-63426379 TGGCTGCTCCCAAGAAAAGGTGG + Exonic
1150820507 17:68430735-68430757 AGGCCTCTGCCAGACAAAGGGGG + Intronic
1151503148 17:74505502-74505524 TACTCACTGCTAAAAAAAGGGGG + Intergenic
1155329000 18:24695254-24695276 TTGTAACTGGCAAAAAAAGGAGG + Intergenic
1156480648 18:37434469-37434491 TGGCCCCTGTCTAAAACAGGGGG + Intronic
1157310600 18:46549923-46549945 AGGCAAATGCCAAAAAAAGCTGG - Intronic
1158666854 18:59440089-59440111 TGGCCACTGATTCAAAAAGGAGG - Intronic
1160865004 19:1252570-1252592 TGGCCGCAGCCAAGAAAATGAGG - Intronic
1164099648 19:22043479-22043501 TGGGCACTGCCAAAGAAAAAAGG - Intergenic
1165743377 19:38216679-38216701 CGGCCACTGCCACAAAGTGGCGG + Intronic
925012708 2:497517-497539 TCACCTCTGCAAAAAAAAGGTGG - Intergenic
926516246 2:13850588-13850610 TGGCCACTGCAAAAAGATGAGGG - Intergenic
928957407 2:36884071-36884093 GGGCCCTAGCCAAAAAAAGGGGG + Exonic
929677773 2:43954722-43954744 TTGCCACTACCAAAACAAAGTGG - Intronic
929697784 2:44133951-44133973 TTGCCACTGCCAACAACATGAGG + Intergenic
930778145 2:55195977-55195999 TGGCCACTGCCAAAGGATGGGGG - Intronic
937211850 2:120278800-120278822 CGGCCAATGCCAAAGGAAGGTGG - Intronic
941333319 2:164207720-164207742 TGGCCACTGCCAAAGGTAAGTGG + Intergenic
941827678 2:169918043-169918065 TTCCCAATGACAAAAAAAGGAGG - Intronic
944391102 2:199220530-199220552 TCACCACCACCAAAAAAAGGAGG - Intergenic
944760230 2:202807255-202807277 TGGCCACTGCCAAGAGATGGTGG - Intronic
947320776 2:228915915-228915937 TGGCCTATGCCAAATAAAGTTGG + Intronic
948117962 2:235507641-235507663 TGGTCACTGCCAGACAGAGGTGG + Intronic
948745513 2:240089976-240089998 TGGGCACTGCCACAAACAGAAGG + Intergenic
1172055210 20:32150035-32150057 TGGCCTCTGACTACAAAAGGAGG - Intronic
1172877114 20:38171109-38171131 AGGCCACAGCCAATAAGAGGAGG - Intergenic
1175573778 20:60044662-60044684 AGGCCACAGGAAAAAAAAGGGGG - Intergenic
1177202829 21:17977249-17977271 TTGCCACTGTCAGAAAAAGCAGG + Intronic
1177605971 21:23378665-23378687 TGCCCATTGCCAAAACAATGGGG + Intergenic
1177634844 21:23774015-23774037 TGGTAACAGCCAAAAAAAGAAGG - Intergenic
1177783889 21:25648996-25649018 AGGCCACTGTTAAAAAGAGGAGG - Intronic
1178168894 21:30016623-30016645 TTGCCACTGCCAAACTAAGCAGG + Intergenic
1181626518 22:24125695-24125717 TGGCCCCTTCCACAAAATGGTGG + Intronic
950774762 3:15339895-15339917 CGGCCTTTGCTAAAAAAAGGGGG + Intronic
950933117 3:16811076-16811098 TGGCCGCTGGCAGAACAAGGAGG - Intronic
951231303 3:20182500-20182522 TAGCCACTGCCAAGGAAATGGGG - Intronic
952385184 3:32836030-32836052 TGGCAACAGCCAAATAAAAGAGG - Intronic
954097970 3:48346245-48346267 TGGCTACTGCAAAAACAAGATGG - Intergenic
955889449 3:63634583-63634605 TGGGCACTGGCAAAACAAGTTGG - Intergenic
958120570 3:89282479-89282501 TGGAAACTACAAAAAAAAGGTGG - Intronic
969485094 4:7467731-7467753 CGGCCACTGCCACAAAATGAGGG + Intronic
974698446 4:65405902-65405924 TGACCTCTGCCAAAAAAAGAAGG - Intronic
976177752 4:82372508-82372530 TGGGCACCGGGAAAAAAAGGGGG + Intronic
977244754 4:94618170-94618192 TGGCAACGGCCAAACCAAGGAGG + Exonic
983207367 4:164924822-164924844 TGACCACTGACAAAGGAAGGAGG - Intergenic
985538496 5:477157-477179 TGGCCACGGCCTAATATAGGAGG + Intronic
985869596 5:2543763-2543785 TGGCCACTGAAAATAAAATGGGG - Intergenic
988557230 5:32247782-32247804 TGATCACTGCCACAATAAGGAGG + Intronic
988707541 5:33740725-33740747 TGGTCACTGCCCAAGACAGGCGG + Intronic
991954617 5:71981473-71981495 TGTCTTCTGGCAAAAAAAGGGGG - Intergenic
995770494 5:115664496-115664518 TGGCCACTGCCAACAGATGTCGG - Intergenic
996821144 5:127629212-127629234 ATGCCACTGGCAAAAAAAAGAGG + Intergenic
996930159 5:128876767-128876789 TGGCCACTGCCAAGAACACAGGG + Intronic
997383182 5:133451914-133451936 TGGCCACAGCCAAAGAGAGAAGG + Intronic
1000709660 5:164556336-164556358 TGGTAACTCCCAAAGAAAGGAGG - Intergenic
1001018503 5:168162987-168163009 TGCCCATTGCCACATAAAGGTGG + Intronic
1007501792 6:42304133-42304155 TGGCCAGTGGCAAAATTAGGTGG + Intronic
1007961446 6:45963498-45963520 GGGCAAATGCCAGAAAAAGGAGG - Intronic
1009039474 6:58159159-58159181 TGGCCACTGCCAAGGAATAGGGG + Intergenic
1009215367 6:60913999-60914021 TGGCCACTGCCAAGGAATGGGGG + Intergenic
1009261909 6:61501977-61501999 AGGCCATTGGCAAAAAAAAGGGG - Intergenic
1012505515 6:99941890-99941912 TGGACACAGCCAAAGAAAGATGG - Intronic
1015160445 6:130147128-130147150 ATGCCACTGTCAAAAACAGGAGG - Intronic
1015241051 6:131023983-131024005 TGAACACTGGAAAAAAAAGGAGG + Intronic
1017323344 6:153118083-153118105 TGGCAAGTGCCAAGGAAAGGAGG + Intronic
1022441615 7:30437713-30437735 TGGCCATTGGCAAAAAAGGAGGG - Intronic
1022756481 7:33297612-33297634 TGCCCACTCCACAAAAAAGGTGG - Intronic
1023228651 7:38000258-38000280 GGGCCACTGCCAAAAAACTGTGG - Intronic
1025212008 7:57025197-57025219 TGGCCACTCCCAACACAATGTGG - Intergenic
1025659946 7:63551631-63551653 TGGCCACTCCCAACACAATGTGG + Intergenic
1027832701 7:83200309-83200331 TGGCCTCTGCCATGAAATGGTGG - Intergenic
1028560350 7:92168365-92168387 TGACAACAGCCAAAAAGAGGAGG + Intronic
1030709682 7:112735633-112735655 CAGCCACTGCCAAAAAAATATGG - Intergenic
1031252031 7:119396382-119396404 TGGACACTGTCACTAAAAGGGGG - Intergenic
1031511490 7:122656259-122656281 TGGCCATGGCAGAAAAAAGGGGG + Intronic
1032606104 7:133355412-133355434 TCGCAACTGCCAAAAAAAACAGG - Intronic
1036721173 8:11176930-11176952 TGGCCAATGCTAAGAGAAGGTGG + Intronic
1037936261 8:22917028-22917050 TGGCCAATGCCAGAATATGGAGG + Intronic
1038352750 8:26794681-26794703 TGGCCATACCAAAAAAAAGGAGG + Intronic
1042203469 8:66304438-66304460 AGGCCAGTGCCACAAGAAGGGGG - Intergenic
1042504576 8:69546111-69546133 TGGCCACTGCAAATAAAATTGGG + Intronic
1044124154 8:88437285-88437307 CAGCCACTGCCAGAAAATGGGGG - Intergenic
1046508901 8:115173143-115173165 AGTCCTCCGCCAAAAAAAGGGGG - Intergenic
1047180298 8:122581331-122581353 TGCCCACAGCTAAAAAAAGCAGG - Intergenic
1049629374 8:143644390-143644412 AGGCCACTGCCAATATAATGAGG - Intronic
1049862036 8:144905482-144905504 TGGCCAATGGAAAATAAAGGGGG - Intergenic
1051033927 9:12719872-12719894 TTTCCAATGCCAAAAAAAGATGG - Intergenic
1051916625 9:22216732-22216754 TTGCCACTGCCAAGGAAGGGGGG - Intergenic
1052450615 9:28625341-28625363 TGGCCACTGCCAGGAGATGGGGG + Intronic
1053587370 9:39473662-39473684 TGCACACTGAGAAAAAAAGGAGG - Intergenic
1055676152 9:78663628-78663650 TGGCCCCTGCCAACAAAGTGAGG + Intergenic
1057149794 9:92786157-92786179 TGGTCTCTGCCTACAAAAGGCGG + Intergenic
1057176222 9:93002278-93002300 TGCCCAATGTCAAAAACAGGAGG + Intronic
1058135048 9:101297888-101297910 TTGCCACTGAAAAAGAAAGGTGG - Intronic
1058369313 9:104246453-104246475 GGACCACTGTCAAAAAAAGAGGG - Intergenic
1061201760 9:129142137-129142159 CTCCCACAGCCAAAAAAAGGGGG - Intronic
1061649113 9:132032041-132032063 TGGGCACTGCCATCAGAAGGTGG + Intronic
1062031878 9:134365501-134365523 TGGCCACAGCCAGAGACAGGAGG - Intronic
1062514843 9:136927628-136927650 TGGCAACTGCTAAAAAGGGGAGG - Intronic
1186652551 X:11576881-11576903 TGGACAATGACAAAAAAAGGGGG - Intronic
1187051198 X:15697272-15697294 TGGCCAGTGCATAAAGAAGGAGG - Intronic
1187713641 X:22079411-22079433 TAGCCACCTCCCAAAAAAGGAGG - Intronic
1188922079 X:35988487-35988509 TGGCCACTGCAAAACTAAGAGGG + Intronic
1192545251 X:72007537-72007559 TGGCTCTTGCCAAAGAAAGGTGG + Intergenic
1195171488 X:102272847-102272869 GGGCCACTGGAAAAACAAGGAGG - Intergenic
1195187372 X:102414252-102414274 GGGCCACTGGAAAAACAAGGAGG + Intronic
1195638627 X:107148777-107148799 TTGCCGCTCACAAAAAAAGGGGG + Intronic
1196032832 X:111109612-111109634 TGGGTACTGGCAAATAAAGGTGG - Intronic
1197846960 X:130813581-130813603 TGGGCACAGCCCAAGAAAGGTGG + Intronic
1198657063 X:138926093-138926115 TCTCCACTGCCAAGAAATGGAGG + Intronic