ID: 921862715

View in Genome Browser
Species Human (GRCh38)
Location 1:220056012-220056034
Sequence CTCCATTCGTAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921862712_921862715 -2 Left 921862712 1:220055991-220056013 CCACTATTTACAGATAGAGAACT No data
Right 921862715 1:220056012-220056034 CTCCATTCGTAGAGGGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921862715 Original CRISPR CTCCATTCGTAGAGGGAAGC AGG Intergenic
No off target data available for this crispr