ID: 921866752

View in Genome Browser
Species Human (GRCh38)
Location 1:220094438-220094460
Sequence GCTGCTGGGCCGCCAGCAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 542
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 479}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921866746_921866752 0 Left 921866746 1:220094415-220094437 CCGCAGACGAGCTTCCCCATGAA 0: 1
1: 0
2: 0
3: 6
4: 110
Right 921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG 0: 1
1: 0
2: 4
3: 58
4: 479
921866745_921866752 19 Left 921866745 1:220094396-220094418 CCGGGACACGGTGCTGCTGCCGC 0: 1
1: 0
2: 2
3: 13
4: 196
Right 921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG 0: 1
1: 0
2: 4
3: 58
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921866752 Original CRISPR GCTGCTGGGCCGCCAGCAGC CGG Exonic
900207027 1:1435978-1436000 GCACCTGGGCCGCCAGCCTCAGG - Intronic
900240611 1:1615723-1615745 GCTGCTGGGCCAGCGGGAGCGGG - Intronic
900243804 1:1628754-1628776 GCTGCGGTGGCGCCGGCAGCAGG + Intronic
900360596 1:2287077-2287099 GCTGCTGTGGGGCCTGCAGCTGG - Intronic
900606519 1:3525999-3526021 GCTGCTGGGCCCCTGCCAGCTGG + Intronic
900657609 1:3767478-3767500 GGTGCTCGGCCGCCAGCTGCTGG - Intronic
900744630 1:4352737-4352759 GCAGCAGGGCTGGCAGCAGCAGG - Intergenic
901061334 1:6473353-6473375 GCCGCTGGGCAGAGAGCAGCTGG + Exonic
901316477 1:8313224-8313246 GCTGCTGGGCTCCCATCAGGAGG + Intergenic
902215496 1:14932052-14932074 GCTGGTGGGCAGCCTGGAGCCGG - Intronic
902369861 1:15999243-15999265 GCAGCTGGGGAGCCAGCAGAGGG + Intergenic
902447396 1:16476013-16476035 CCTGCAGGGCCGGCAGCGGCAGG - Intergenic
902467249 1:16625963-16625985 GCTGCAGGGCCGGCAGCGGCAGG - Intergenic
902482646 1:16719703-16719725 GCTGCCCGGCCGCACGCAGCTGG - Intergenic
902509524 1:16958633-16958655 GCTGCAGGGCCGCCTGGCGCTGG + Exonic
902548931 1:17208000-17208022 GCAGCTGGGCTGGCAGCAGGAGG + Intronic
902660315 1:17896264-17896286 GCTCCTGGGCCCCCATCAGGAGG - Intergenic
902747311 1:18482442-18482464 GCTCCGGGGCCGCCAGTACCTGG + Exonic
902921086 1:19666239-19666261 GCTGCTGGGCTGGCACGAGCTGG + Exonic
902923149 1:19679218-19679240 GCAGCTGGGCCGTGAGCCGCAGG - Exonic
903331964 1:22601105-22601127 GCAGCTGGGCCTCAAGGAGCTGG - Intronic
904625145 1:31798236-31798258 GCAGCTGGCCCCCCAGGAGCTGG - Exonic
904773296 1:32893042-32893064 GCTGCGGGGCCGTCTGCTGCCGG - Intronic
905371215 1:37483545-37483567 GCTCCTGGACCCCCAGCAGCTGG + Exonic
905416695 1:37808693-37808715 GCAGCTGGGCCGCCGGCGCCCGG + Exonic
907489685 1:54800971-54800993 GCTGCGGGGCGGCCGCCAGCTGG + Exonic
910429033 1:87143075-87143097 GTTGCTGAGCCACCAGCAGCTGG - Intronic
911662871 1:100523282-100523304 CCAGCTGGGCCTCAAGCAGCAGG - Intergenic
912381448 1:109250005-109250027 GCGGCGGGGCCGGCAGGAGCCGG + Exonic
913269107 1:117075551-117075573 GCCGCTGGTCCTCCAGGAGCAGG - Exonic
913300732 1:117366919-117366941 GCTGCTGGGCCGACACCCGTTGG - Intergenic
913570066 1:120110854-120110876 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914290875 1:146271820-146271842 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914551919 1:148722603-148722625 GCTGCTGGGGAGACATCAGCCGG + Intergenic
914950286 1:152108053-152108075 GCAGCTGCGCCGCCAGGAACTGG - Exonic
914950409 1:152109052-152109074 GCGGCTGCGCCGCCAGGAACGGG - Exonic
915164765 1:153942333-153942355 GCTGCTGGGCCGCTACCCGGAGG - Exonic
915286983 1:154859360-154859382 GCTCCTGGGCTGCCAGCAAGTGG - Intronic
915300211 1:154947419-154947441 GCAGCTGGGCCTGCAGCAGCCGG + Exonic
915544940 1:156591822-156591844 GCTGCTGGGCCTCGGGCTGCTGG + Exonic
915589275 1:156861362-156861384 GCAGCTGGGCCGCCGGCTTCAGG + Intronic
916108690 1:161448057-161448079 GCGGCTTGGTCGCCCGCAGCCGG - Intergenic
916110278 1:161455438-161455460 GCGGCTTGGTCGCCCGCAGCCGG - Intergenic
916111863 1:161462848-161462870 GCGGCTTGGTCGCCCGCAGCCGG - Intergenic
916113450 1:161470229-161470251 GCGGCTTGGTCGCCCGCAGCCGG - Intergenic
917637262 1:176949234-176949256 GCAGCTGTGCCTCCAGCAGATGG - Exonic
919758236 1:201079364-201079386 GCTGCTGGGAGGTCAGGAGCAGG - Intronic
920179672 1:204124699-204124721 GCGGCTGAGCCGGCAGCACCTGG + Exonic
921866752 1:220094438-220094460 GCTGCTGGGCCGCCAGCAGCCGG + Exonic
923119674 1:230978635-230978657 GCTGCAGCACCGGCAGCAGCAGG - Exonic
924727431 1:246683532-246683554 GCTGCTGCGCTGCCATGAGCGGG + Intergenic
1064100873 10:12463028-12463050 TCTGTTGGGCAACCAGCAGCTGG + Intronic
1064582708 10:16810447-16810469 GCTGCTGGGGGAACAGCAGCAGG - Intronic
1064808794 10:19168769-19168791 GGTGCTGAGCCACCAGCAGGGGG - Intronic
1066432239 10:35363018-35363040 GGTGGTGGGCCGCCGGCGGCCGG + Intronic
1067078365 10:43200684-43200706 GCTGCTGGGCCAGCACCAGGGGG + Exonic
1067569597 10:47361584-47361606 GGTGCAGGGTCGCCACCAGCCGG - Intergenic
1069719590 10:70541110-70541132 CCCGCAGGGCCTCCAGCAGCTGG - Exonic
1071596671 10:86932928-86932950 GCTGCTGGGCCTCTGGAAGCAGG - Intergenic
1076254785 10:129013581-129013603 GAAGGTGGGCCGCCATCAGCAGG - Intergenic
1076701364 10:132274999-132275021 GGTGCTGGGCCCTCAGAAGCTGG - Intronic
1076779184 10:132714576-132714598 GCTGCGGGGCCGGCAGCACCAGG + Intronic
1076893605 10:133297665-133297687 GCTGTGGGGCAGCCTGCAGCAGG - Intronic
1077216347 11:1396731-1396753 CCTGCTGGGCAGCCGGCACCAGG + Intronic
1077258008 11:1597810-1597832 GCAGCTGGACTGGCAGCAGCAGG + Exonic
1077259416 11:1607921-1607943 GCAGCTGGGCTTGCAGCAGCTGG + Exonic
1077262562 11:1630499-1630521 GCAGCTGGACTGGCAGCAGCAGG - Exonic
1077415241 11:2421707-2421729 GCAGTCGGGCCGCCAGCTGCAGG - Intronic
1077543295 11:3157757-3157779 CCTGCTGGGCTTGCAGCAGCCGG + Intronic
1078549673 11:12271451-12271473 GCAGCTGGGCCTCCGGCTGCTGG - Intergenic
1078929693 11:15903624-15903646 TCTGCTGAGCTGCCTGCAGCTGG - Intergenic
1079107039 11:17578369-17578391 CCTGCTGGGCAGGCAGCAGCTGG - Exonic
1079355054 11:19723736-19723758 CCTGCTGGGCCGGCAGCACGGGG - Intronic
1081484725 11:43518825-43518847 GCTGATGGGAAGCCGGCAGCTGG - Intergenic
1081664237 11:44907170-44907192 GTGGGTGGGCCGCCAGCAGGTGG - Intronic
1081984227 11:47289951-47289973 GCTGCTCGCTCTCCAGCAGCCGG - Exonic
1083636874 11:64125558-64125580 GCTCCTGCCCCGCCAGCAGCTGG + Intronic
1083677164 11:64332548-64332570 GCTCCGGGGCTGCCTGCAGCAGG + Intergenic
1083890125 11:65591833-65591855 GCTGCTGAGCCGCGAGCTGCGGG + Exonic
1084175149 11:67419012-67419034 GCAGCCGGTCCTCCAGCAGCCGG - Exonic
1084188527 11:67488315-67488337 ACTGCCGGGCTGCCATCAGCGGG - Intronic
1084195109 11:67520104-67520126 GCTGATGGGCCCCAAGCTGCTGG - Exonic
1084666790 11:70580706-70580728 CTGGCTGGGCAGCCAGCAGCGGG - Intronic
1084741881 11:71145556-71145578 CCTGCTGGACCGCAAGCTGCTGG + Intronic
1084798831 11:71527656-71527678 GCAGCTGGACTGGCAGCAGCAGG - Exonic
1084803979 11:71566081-71566103 GCAGCTGGACTGGCAGCAGCAGG - Exonic
1084803987 11:71566141-71566163 GCAGCTGGACTGACAGCAGCAGG - Exonic
1084804369 11:71568759-71568781 GCAGCTGGACCGGGAGCAGCAGG - Intronic
1084806431 11:71582400-71582422 GCAGCTGGACTGGCAGCAGCAGG + Exonic
1084806440 11:71582475-71582497 GCAGCTGGACTGGCAGCAGCTGG + Exonic
1084889736 11:72230780-72230802 GCTGCTGTTCCCCCAGAAGCGGG + Exonic
1085136849 11:74098215-74098237 GGTACTGGGCATCCAGCAGCAGG + Exonic
1085328510 11:75627280-75627302 GCTGATGGTCCAGCAGCAGCTGG + Intronic
1087009604 11:93500840-93500862 GCTACTGAGCCAACAGCAGCAGG - Intronic
1088465604 11:110134372-110134394 GCTGCTTGGCAACCAGAAGCTGG - Intronic
1089494551 11:118901690-118901712 GCTGCTGCGGCACCAGCTGCTGG - Exonic
1089827565 11:121292742-121292764 GCAGCTGGGCAGCCAGCAAGCGG - Exonic
1090102535 11:123815299-123815321 GCTGCTGGGCTGGCAGGAGATGG - Intergenic
1090670247 11:128940873-128940895 GCTTCAGCGCCGCCAGCATCAGG + Intronic
1094552411 12:31465188-31465210 GCTCCTGTGCCGCCAGCCACAGG - Intronic
1096518723 12:52172316-52172338 GCTGCAGGGCGGCCTCCAGCTGG + Exonic
1097040627 12:56153979-56154001 GCTGCTAAGCCAGCAGCAGCAGG + Exonic
1097262433 12:57727132-57727154 GCCGCTGGGCCGCCAGCTGTGGG - Exonic
1097961571 12:65536428-65536450 TTTGCTGGGCCACCACCAGCTGG + Intergenic
1098214427 12:68200484-68200506 GCTCCTGGGCCATCAGCAGCAGG - Intergenic
1098268850 12:68750727-68750749 GCTGCTGTGCCCCAAGGAGCAGG + Intronic
1098698172 12:73585954-73585976 GCTGCTGAGAAGCCTGCAGCCGG - Intergenic
1101092779 12:101304688-101304710 GCTGCTGAGCCCCCTGCAGTGGG + Intronic
1101437861 12:104679564-104679586 GCTGATGAGACCCCAGCAGCTGG + Intronic
1101445106 12:104731931-104731953 TCTGCTGGGCTGCCAGCCCCTGG - Intronic
1101866389 12:108523515-108523537 GCTGCTGGGGCGGCAACTGCAGG + Exonic
1102351932 12:112199067-112199089 GCTGTTGAGCCGCCGGCCGCAGG + Intronic
1102626097 12:114236575-114236597 GCGTCTGTGTCGCCAGCAGCAGG + Intergenic
1102882642 12:116497510-116497532 GCCACTGGCCAGCCAGCAGCAGG - Intergenic
1104538491 12:129640833-129640855 GCTGCTGAGCTGACAGGAGCTGG - Intronic
1104918549 12:132278784-132278806 GCTGCAGGGCCGACAGCTCCAGG - Intronic
1105029479 12:132872852-132872874 AATGCTGGGCCGTCAGCTGCAGG + Intronic
1105439549 13:20403925-20403947 GCTGCTGTGCCGCCAGGCCCAGG + Exonic
1106406615 13:29480226-29480248 GAGGCTGGGCTGGCAGCAGCAGG + Exonic
1106683421 13:32031465-32031487 GCTGGTGGGCGGCCGGCAGCCGG + Exonic
1107307414 13:39037827-39037849 CCTGCCGGGCCGCCTGCTGCCGG - Exonic
1108478374 13:50843214-50843236 GCTGCTGGGGCCCCTCCAGCAGG - Exonic
1109183261 13:59240029-59240051 GCTGATGGGCTGACAGAAGCTGG + Intergenic
1111195745 13:84872406-84872428 GCTGCAGGGCCCCCATCAGCTGG - Intergenic
1111284407 13:86069451-86069473 GCTTCTGTGCGGCAAGCAGCAGG - Intergenic
1112284814 13:98094840-98094862 GCTGCTGAGCAGCCACCACCAGG - Intergenic
1112460995 13:99603824-99603846 GCTGCTGTGCCCCCAGCACCTGG - Intergenic
1113442675 13:110341315-110341337 GGGGCTGGACGGCCAGCAGCTGG - Intronic
1113947645 13:114053150-114053172 GCGGCTGGGCAGTCAGCAGCAGG - Intronic
1114655009 14:24310742-24310764 CCAGCAGCGCCGCCAGCAGCAGG - Exonic
1116937590 14:50758122-50758144 GCAGCTGGCCAGCCAGCGGCTGG - Exonic
1118374196 14:65162743-65162765 CCTCCTGGGCCCCTAGCAGCTGG + Intergenic
1118842285 14:69522300-69522322 GCTTCTCGGCCTCCAGCACCTGG - Exonic
1119261649 14:73241302-73241324 GCAGCTGGGCCACCAGCACGTGG - Intronic
1119646115 14:76349733-76349755 CCTGCTGGGTCCCCAGCACCTGG + Intronic
1119789863 14:77340523-77340545 GCTGCTGGGCCCCCAGGCGGAGG - Exonic
1121017284 14:90556418-90556440 GCAGCAGGCCCCCCAGCAGCAGG - Intronic
1121098606 14:91234432-91234454 CCTGGTAGGACGCCAGCAGCAGG + Exonic
1121710814 14:96038314-96038336 CCTACTGGGCCCCCAGCTGCCGG + Intergenic
1122281041 14:100622552-100622574 GCTGGTGGGCCTGCAGCAGGAGG - Intergenic
1122425229 14:101601845-101601867 ACTGCTGGGCTGCCAGGGGCCGG - Intergenic
1122686885 14:103512881-103512903 GCGGCTGGGCCGCCAACTCCTGG + Intergenic
1122837490 14:104437289-104437311 GGGGCTGGGCCTCCTGCAGCTGG - Intergenic
1122884979 14:104706948-104706970 GCTGCAGGGCCTCCTGCACCTGG + Exonic
1124706675 15:31972295-31972317 GCTGCTGAGTGGCCAGCAGGCGG - Intergenic
1125589888 15:40847490-40847512 GCTGCTCCGCCTCCAGCTGCAGG - Intronic
1125728306 15:41879360-41879382 GCTGCAGGGCCTCCAGCTGGAGG + Exonic
1126937920 15:53731745-53731767 CCTCCTGGGCAGCCAGCACCAGG + Intronic
1128224633 15:65993386-65993408 GCTGCTGGGCCGCTGGGAGCTGG - Intronic
1128736135 15:70055012-70055034 GCTGCTGCGCCGCCTCCAGCTGG - Intronic
1129524237 15:76203997-76204019 GCTGCTGGGATGGCAGCGGCGGG - Exonic
1129530652 15:76261633-76261655 GCTGCTGTGGCGGCAGCAGCAGG + Intronic
1129921363 15:79322043-79322065 GGTCCTGGGCCTCCCGCAGCCGG - Exonic
1131179079 15:90228061-90228083 GCTGGTGGGCACCCAACAGCTGG + Exonic
1131831828 15:96359575-96359597 GCTGCTTGAGCGCCAGCAACAGG + Intergenic
1132111656 15:99106043-99106065 GGTGCTGGGGCGACGGCAGCGGG - Intronic
1132331321 15:101014161-101014183 GCTGCTGGGCCCCACACAGCTGG + Intronic
1132331387 15:101014524-101014546 GCTGCTGAGCCGCCAGCTGGGGG + Intronic
1132589974 16:722311-722333 GCAGCTTGTCCTCCAGCAGCGGG - Exonic
1132803189 16:1764012-1764034 GTGGCTGTGCCGCCAGAAGCTGG + Intronic
1132884069 16:2174816-2174838 GCAGCTTGACTGCCAGCAGCCGG + Intronic
1132887590 16:2189433-2189455 CATGCTGGGCCGCCAGGTGCAGG + Exonic
1133015301 16:2936944-2936966 TCTGCTGGGGCTCCAGCTGCTGG - Intronic
1133318566 16:4899033-4899055 GGTGCTCGGCCGCCAGCAGCTGG + Exonic
1134014271 16:10877815-10877837 GCTGTTGAGCCCTCAGCAGCTGG + Intronic
1134786923 16:16952964-16952986 GCTGCTGGGCCAGCAGCGGTTGG + Intergenic
1135076458 16:19398449-19398471 GCTGCAGGGCCCCCATCAGCTGG + Intergenic
1135281723 16:21158725-21158747 GCTGCTCGGCGGTCAGGAGCAGG + Exonic
1136736968 16:32474749-32474771 GCTGCTGTGCGGCCAGCACTGGG + Intergenic
1139289436 16:65844133-65844155 GCTGCTGCACAGCCAGCTGCTGG - Intergenic
1139432577 16:66918959-66918981 GCCACTGGGCCCACAGCAGCAGG + Exonic
1139507121 16:67404356-67404378 GGTGCTGGGCCCCCAGCTGAAGG - Intronic
1139511645 16:67431332-67431354 GCGTCTGGGCCGCCCGCTGCTGG + Exonic
1139511649 16:67431344-67431366 GCGCCAGCGCCGCCAGCAGCGGG - Exonic
1139776686 16:69320830-69320852 GCACCCGGGCTGCCAGCAGCAGG - Intronic
1140302413 16:73771317-73771339 GCTGTTGGGGCGCCATCACCAGG - Intergenic
1141418975 16:83899402-83899424 ACTGCTGGGCCGCCTGGCGCGGG + Exonic
1141501598 16:84448616-84448638 TCTGCTGGGGCGTCAGCGGCAGG - Exonic
1141703105 16:85651390-85651412 GCTGGGGGGCAGCCAGCAGGCGG - Intronic
1142178911 16:88657769-88657791 CCCGCTGGGCCGCCAGCTCCAGG - Intronic
1142257606 16:89022305-89022327 GCAGCTGGGGCTCCCGCAGCCGG - Intergenic
1203016103 16_KI270728v1_random:354828-354850 GCTGCTGTGCGGCCAGCACTGGG - Intergenic
1203034438 16_KI270728v1_random:627986-628008 GCTGCTGTGCGGCCAGCACTGGG - Intergenic
1143390227 17:6555848-6555870 GGGGCGGGGCGGCCAGCAGCCGG + Intronic
1144666601 17:17106364-17106386 GATCCTGGGCAGGCAGCAGCAGG + Intronic
1144702968 17:17350795-17350817 GCAGCGGGGCCTCCAGCAGGGGG + Intergenic
1144891049 17:18494577-18494599 GCACCTGGGGCGCCAGCTGCTGG + Exonic
1145063202 17:19745027-19745049 GCTGCAGCGCCTCCAGCTGCTGG + Exonic
1145141174 17:20449741-20449763 GCACCTGGGGCGCCAGCTGCTGG - Intronic
1145193498 17:20867620-20867642 TCTGCTGCACTGCCAGCAGCAGG - Intronic
1145235309 17:21203758-21203780 GCTGCTGGGTGGTCAGGAGCTGG - Intronic
1146167381 17:30600614-30600636 ACGGCTGGGGCGCCAGCGGCCGG + Intergenic
1146685241 17:34837079-34837101 GATGCTGGGCAACCAACAGCTGG + Intergenic
1146957106 17:36942304-36942326 GCTGGTGGACCGCCTGGAGCCGG + Exonic
1147506875 17:41026901-41026923 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147506878 17:41026931-41026953 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147506892 17:41027039-41027061 GCTGCGTGGCTGGCAGCAGCTGG + Exonic
1147506895 17:41027069-41027091 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507165 17:41030022-41030044 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507556 17:41034597-41034619 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507569 17:41034705-41034727 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147507572 17:41034735-41034757 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147508203 17:41041251-41041273 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147508210 17:41041311-41041333 GCAGCTTGGCTGGCAGCAGCTGG + Exonic
1147512627 17:41084451-41084473 GCAGCTGGGGCGGCAGCAGCTGG - Exonic
1147512639 17:41084526-41084548 GCAGCTGGGGCGGCAGCAGGTGG - Exonic
1147512644 17:41084541-41084563 GCAGCAGGGGCGGCAGCAGCTGG - Exonic
1147513860 17:41097638-41097660 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147513870 17:41097698-41097720 GCAGCTGGGGCGGCAGCAGTTGG + Exonic
1147513882 17:41097773-41097795 GCAGCTGGGGCGGCAGCAGCTGG + Exonic
1147513899 17:41097878-41097900 GCAGCTGGGGCGACAGCAGGTGG + Exonic
1147514392 17:41102006-41102028 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147514817 17:41105753-41105775 GCAGCTGGGGCGACAGCAGCTGG - Exonic
1147514828 17:41105828-41105850 GCAGCTGGGGCGGCAGCAGTTGG - Exonic
1147514838 17:41105888-41105910 GCAGCAGGGGCGGCAGCAGCTGG - Exonic
1147515955 17:41117839-41117861 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147515977 17:41117974-41117996 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147515993 17:41118079-41118101 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147516579 17:41123628-41123650 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147516589 17:41123688-41123710 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147516610 17:41123808-41123830 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147516623 17:41123883-41123905 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147516632 17:41123928-41123950 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147516645 17:41124003-41124025 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147517967 17:41140131-41140153 GCAGCTGGGGCGACAGCAGCTGG + Exonic
1147517993 17:41140293-41140315 GCAGCTGGGACGGCAGCAGGTGG + Exonic
1147518006 17:41140368-41140390 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147518881 17:41149333-41149355 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147518914 17:41149528-41149550 GCAGCAGGGGCGGCAGCAGCTGG + Exonic
1147518936 17:41149648-41149670 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147519824 17:41160242-41160264 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147519849 17:41160377-41160399 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147519884 17:41160572-41160594 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147520493 17:41167771-41167793 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147520505 17:41167861-41167883 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147520519 17:41167951-41167973 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147520533 17:41168041-41168063 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147521527 17:41177925-41177947 GCAGCTGGGACGGCAGCAGGTGG + Exonic
1147521546 17:41178045-41178067 GCAGCTGGGGCGGCAGCAGGTGG + Exonic
1147524857 17:41212917-41212939 GCAGCAGGGCTGGCAGCAGCTGG - Intronic
1147524888 17:41213095-41213117 GAAGCTGGGCTGGCAGCAGCTGG - Intronic
1147528994 17:41255783-41255805 GCAGCAGGGCTGGCAGCAGCTGG - Exonic
1147530469 17:41271618-41271640 GGAGCTGGGCTGGCAGCAGCTGG - Intergenic
1147530487 17:41271723-41271745 GCAGCAGGGCTGGCAGCAGCTGG - Intergenic
1147530883 17:41275990-41276012 GGAGCTGGGCTGGCAGCAGCTGG - Exonic
1147578472 17:41615831-41615853 GCTGCAGGGCCCCCAGCCTCGGG + Intronic
1147743140 17:42679936-42679958 GCTTCTGGGCCGCACGCTGCTGG - Exonic
1147818617 17:43228470-43228492 GCTGATGGCCCAGCAGCAGCAGG - Intergenic
1147831900 17:43303172-43303194 GCTGATGGCCCAGCAGCAGCAGG - Intergenic
1148161214 17:45451261-45451283 GCGGATGGGCAGCCAGCAGGGGG + Intronic
1148341584 17:46876507-46876529 CTTGCTGGGCCGGCAGAAGCTGG - Exonic
1148555816 17:48578021-48578043 GCTCCTGCGCCGCCACCCGCCGG - Exonic
1148793187 17:50184980-50185002 GGTGCTGGGCGGGCAGGAGCGGG + Exonic
1150132836 17:62678563-62678585 GCAGCTGGGCCCCCAGCTCCTGG - Exonic
1150377557 17:64694470-64694492 GCTGCTGGGCTGCTGGCAGCAGG - Intergenic
1150726087 17:67652650-67652672 GCTGCCGGGCCGAGAGGAGCTGG + Intronic
1150777119 17:68090021-68090043 GCTGCTGGGCTGCTGGCAGCAGG + Intergenic
1151362548 17:73597220-73597242 GGTGCTGGGTAGCCAGCACCAGG - Intronic
1151732125 17:75917818-75917840 GCGGCTGGGCCAGCAGCAGCGGG - Exonic
1152583396 17:81178835-81178857 CCAGCTGGGCAGACAGCAGCTGG - Intergenic
1152586236 17:81190661-81190683 GCTGCAGGCCCGCCAGCAGCTGG - Exonic
1152640876 17:81448725-81448747 GCTGCTGGCCCGCACGCGGCAGG + Intronic
1152800394 17:82328156-82328178 GCTGCTGGGCAGCTTCCAGCAGG + Intronic
1152810548 17:82379870-82379892 GCTGCGGGGTCGCCAGCGGGCGG - Intergenic
1152870856 17:82752307-82752329 GCTGCTGGGCCGCCTGCGGGAGG + Exonic
1153238909 18:3013307-3013329 GCTGCCCGCCCGCCAGCTGCCGG - Intronic
1153707133 18:7757526-7757548 ACCCCTGGGCAGCCAGCAGCAGG + Intronic
1153964494 18:10167487-10167509 GTTGCAGGGCAGCCAACAGCTGG + Intergenic
1156496678 18:37530467-37530489 CTTGCTGGGCAGGCAGCAGCTGG - Intronic
1157384306 18:47248337-47248359 TCTGCTGGGCCCCCACCTGCTGG - Intronic
1157595062 18:48859358-48859380 GCAGCTGTTCCTCCAGCAGCCGG - Exonic
1157752970 18:50194820-50194842 GCCGCGGGGCAGCCAGGAGCCGG - Exonic
1160163358 18:76491634-76491656 GTTGCTGGGCTGCCAGGAGGAGG - Intronic
1160790951 19:923505-923527 GCTGCTGTGCCCCCAGGAGATGG + Intergenic
1160792622 19:929582-929604 GCTGCCGGGCCTCCAGCTCCTGG - Exonic
1160805914 19:992100-992122 GCGCCTGGGCCTCCACCAGCAGG + Exonic
1160821754 19:1062244-1062266 GCTGACGGGCCGCGAGCACCTGG + Exonic
1161042140 19:2115979-2116001 GCAGCTGGGCTGCCAGGCGCAGG + Intronic
1161238074 19:3207763-3207785 CCTGCAGGGCCGCCCGCGGCGGG - Exonic
1161298555 19:3532011-3532033 GCTGCAGGGCCACCGGCAGGAGG + Exonic
1161720388 19:5899013-5899035 GCTGCTGGGCCAGGAGCAGGTGG - Intronic
1162113263 19:8413035-8413057 GCTGCTGCGCCACCTGCAGACGG - Intronic
1162328047 19:10010319-10010341 GCTGCAGCGCGGCCAGGAGCAGG + Exonic
1162373358 19:10291604-10291626 GCTCCTGGGCGCCCCGCAGCAGG - Exonic
1162397477 19:10425433-10425455 GGTGCTGGGCAGCCAGGAGCTGG + Intronic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1162937831 19:13990348-13990370 GCTGCTGGACCCCCTGCAGCTGG - Intronic
1162937832 19:13990351-13990373 GCTGCAGGGGGTCCAGCAGCTGG + Intronic
1163161869 19:15469697-15469719 GCTGCTGGGCCACCGCCAGCTGG - Exonic
1163689760 19:18732083-18732105 GATGCTGGGCCCCCAGGGGCAGG + Intronic
1163697870 19:18773065-18773087 TCTGCTGGGCAGCGAGCAGGTGG + Intronic
1163713726 19:18862165-18862187 GCGGCTGGGCAGCATGCAGCAGG - Intronic
1165062338 19:33210984-33211006 GCTGCTGGGCCCGGAGCAGGAGG - Intronic
1165471515 19:36007184-36007206 GGGGCTGGGCCGCCGGCTGCAGG - Exonic
1166524328 19:43501739-43501761 GCAGCGCGGCCGCCAGCAGCGGG - Exonic
1166840264 19:45692889-45692911 GCCGCTGGGCCGGGAGCTGCGGG + Exonic
1166862174 19:45816875-45816897 GCTGCTGGGGCGGCAGCTGCAGG + Exonic
1167649711 19:50722690-50722712 GCTGCTGGTCTGCAAGCAGCTGG + Intergenic
1168694169 19:58395636-58395658 GTTCCTGGCCTGCCAGCAGCTGG - Intergenic
925025727 2:605883-605905 GCGGCCGGGCCTCCAGCCGCAGG - Intergenic
925413249 2:3652188-3652210 GCCCCTCGGCTGCCAGCAGCAGG + Intergenic
925780617 2:7378509-7378531 GATGCTGTGCCGCCAGCTCCTGG + Intergenic
927003951 2:18828136-18828158 GCTGCAGGGTCACCTGCAGCTGG - Intergenic
927419227 2:22912611-22912633 GCAGCTGGAGCGCCAGAAGCAGG + Intergenic
927684491 2:25161239-25161261 TCTTCTCGGCCGCCACCAGCAGG + Exonic
927990315 2:27442646-27442668 GCAGCACGGCCCCCAGCAGCAGG - Exonic
929438613 2:41948225-41948247 GCTGCTGTTCAGCAAGCAGCAGG + Intronic
930136101 2:47905591-47905613 GCTGCTGGGGCGGCTGCTGCTGG + Exonic
931695207 2:64865808-64865830 GCTCCTGAGCCGGGAGCAGCCGG + Intergenic
932158237 2:69437526-69437548 GCAGCAGGACCGCCCGCAGCCGG - Exonic
935901882 2:107801712-107801734 GCTGTGGGGCTGGCAGCAGCGGG - Intergenic
935971525 2:108534456-108534478 GCTCCGGGCCCGCCAGTAGCCGG + Intronic
937204260 2:120225537-120225559 ACTGCTATGCCGCCAGCACCTGG - Intergenic
937328413 2:121006152-121006174 GCTGCAGGGACACCGGCAGCAGG - Intergenic
938392511 2:130916548-130916570 ACTGCAGGGCCGGCAGGAGCGGG + Intronic
940115914 2:150208228-150208250 GCTGCTTGGCACTCAGCAGCTGG + Intergenic
942278965 2:174342303-174342325 GCGGCTGGGCAGGCAGGAGCCGG + Intergenic
942653982 2:178195256-178195278 GCTGCAGGGGCGCCAGCAGCGGG - Intronic
943624088 2:190180296-190180318 GCTGCGGGGCCCCCTGCAGGCGG + Intronic
946023698 2:216659206-216659228 GCTGCTGGAGTGCCAGCACCCGG + Intronic
947819962 2:233062666-233062688 GCTGCTGGGCTGCAAACACCAGG + Intronic
947913963 2:233819985-233820007 GGTGGTGGTGCGCCAGCAGCAGG - Exonic
948424360 2:237877949-237877971 GGTGCTGGGCCCCCATCAGCAGG + Intronic
948843653 2:240672655-240672677 GGTGCTGGGCGATCAGCAGCAGG - Intergenic
948843732 2:240672980-240673002 GCTGCAGCGGCGCCAGCTGCGGG - Intergenic
948850034 2:240701338-240701360 GCTGCTGCGGCGCCAGCCGCGGG + Intergenic
948929002 2:241118877-241118899 GCTCCTGGACCCGCAGCAGCTGG + Intronic
1168786435 20:543753-543775 ACGGCTCGGCCGCCAGCCGCAGG + Exonic
1168913278 20:1466913-1466935 GCTGCTGGGCCCTCATCGGCTGG - Exonic
1169200390 20:3706437-3706459 GCTGCAGGTCCTTCAGCAGCAGG + Exonic
1169276556 20:4237038-4237060 GCTGCTGGGACCTTAGCAGCTGG + Intronic
1170571557 20:17635601-17635623 GCAGCTGGCCCGCCTGCAGCAGG - Exonic
1171150356 20:22822149-22822171 GCTCCTGGGCTGTCTGCAGCCGG - Intergenic
1171451155 20:25237104-25237126 ACTGCAGGGCCCCCAGCAACAGG + Intergenic
1172110424 20:32541512-32541534 GCTGATGGGCCGCCTGAAGCCGG + Intronic
1172117697 20:32582399-32582421 GCAGCTGGGCCGGCAGGACCTGG + Intronic
1172624639 20:36340216-36340238 GCTGTTGGGCAGCCAGGAGAAGG - Intronic
1173250606 20:41362446-41362468 ACAGCTGGGCAGCCAGCTGCAGG - Exonic
1173561194 20:44006765-44006787 GCAGCTGGCCCGACAGCAGGTGG - Exonic
1173704673 20:45101030-45101052 GCAGCGGGGCCGCCTGCAGCAGG - Exonic
1174072058 20:47906176-47906198 GCTGCTGTGTGTCCAGCAGCTGG - Intergenic
1174147191 20:48460150-48460172 GCTGCTGTGTGTCCAGCAGCTGG + Intergenic
1174151984 20:48492493-48492515 GCTGCTGTGTGTCCAGCAGCTGG + Intergenic
1174325478 20:49775374-49775396 GCTCCTGTGTGGCCAGCAGCTGG - Intergenic
1174370400 20:50083203-50083225 GCTGCTGGGCTGGCGGCTGCCGG + Intronic
1174561290 20:51432484-51432506 CCTGCTGGGCTATCAGCAGCCGG - Exonic
1175225394 20:57441326-57441348 GCAGCTGGGCCAGCAGTAGCAGG + Intergenic
1175247766 20:57591873-57591895 GCTGCTGGGGCGCCGGGAGGGGG + Intergenic
1175777716 20:61663588-61663610 GCTGCTGGGACGGCAGGACCGGG + Intronic
1176109258 20:63404119-63404141 CCTGCTGGGCGGCCAGCTTCTGG + Intergenic
1176198464 20:63848507-63848529 GCTGCTCAGCCCCCAGGAGCTGG - Intergenic
1176709460 21:10136825-10136847 GCGGCAGGGCCTTCAGCAGCAGG - Intergenic
1178992561 21:37367479-37367501 GCTGCGGCGCGGCCAGGAGCCGG + Intronic
1179499822 21:41801263-41801285 GCTGCTGCTCCGCCTGCACCTGG + Exonic
1180157857 21:45986735-45986757 GCTGCAAGGCCCCCGGCAGCTGG + Intronic
1180228289 21:46411482-46411504 GCTCCTGGTCAGCCAGCAGCCGG - Exonic
1180614707 22:17119960-17119982 GCCGCTGGGGCTGCAGCAGCAGG + Exonic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181030601 22:20147422-20147444 GGTGCTGGACCCCCTGCAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181512709 22:23395959-23395981 GGTGCTGGACCCCCTGCAGCAGG + Intergenic
1182485573 22:30636687-30636709 TGTGCAGGGCCGACAGCAGCAGG - Exonic
1182704849 22:32270669-32270691 GCTGCTGGGCATCCACCTGCTGG + Intergenic
1183754397 22:39746730-39746752 GGTGCTGGGAGGCCAGCAGGGGG + Intronic
1183969872 22:41468813-41468835 GCTGCTGGGCGGCCAGGTCCTGG + Intergenic
1184726595 22:46350901-46350923 GCTGCTGGGCCGCGAGGAATTGG + Intronic
1185019693 22:48366946-48366968 GCTGCTGGGCCCACAGATGCTGG - Intergenic
1185304631 22:50107636-50107658 ACCGCTGGGCCTCCCGCAGCTGG - Intronic
1185338263 22:50280384-50280406 CCTGTTGGGCCCCCAGGAGCCGG - Intronic
1185380543 22:50505716-50505738 GCTGCTGGACGACCAGCACCTGG - Exonic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
950630101 3:14276622-14276644 GCTGCAGGGACTCCAGCTGCAGG - Intergenic
954256569 3:49411697-49411719 GCGGCTCGGCCACGAGCAGCCGG + Intronic
954682357 3:52352635-52352657 GCTGAAGGACTGCCAGCAGCTGG + Exonic
955963951 3:64368911-64368933 TCTGCTGGACAGCCAGCTGCTGG - Intronic
956277319 3:67516664-67516686 ACTGCTGTGTTGCCAGCAGCTGG - Intronic
962318146 3:134371322-134371344 GCTGCTAGCCATCCAGCAGCAGG - Exonic
964378222 3:156070642-156070664 CTTGCTGTGCAGCCAGCAGCAGG - Intronic
966786622 3:183628774-183628796 CCTGCTGGGATTCCAGCAGCAGG + Intergenic
966936328 3:184711993-184712015 GCCGCAACGCCGCCAGCAGCCGG + Exonic
968088378 3:195884939-195884961 CCTGCTGGGCCCCCAGGGGCGGG + Exonic
968431121 4:559757-559779 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431125 4:559772-559794 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431139 4:559832-559854 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431146 4:559862-559884 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431153 4:559892-559914 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968431174 4:559982-560004 GGTGCTGGGACGCCAGGTGCTGG - Intergenic
968467942 4:762363-762385 GCCCCTGGGCCACCAGCAGCTGG + Intronic
968620985 4:1603421-1603443 GCTGCTGGGCCGCCCACCGCAGG + Intergenic
968752423 4:2396954-2396976 GCTGCTGTGCCGAGAACAGCCGG + Intronic
969423586 4:7111095-7111117 TCTGCAGGGCCCCCAGCATCGGG - Intergenic
969588535 4:8108424-8108446 ACTCCTGGGCCGGCAGCTGCAGG - Intronic
969611844 4:8231977-8231999 GCCGCTGGACGGCCCGCAGCTGG - Exonic
969651118 4:8468922-8468944 GCTGCTTGGCCGCCAGAGGGTGG + Intronic
971385471 4:26137478-26137500 TCTGATGGGCAGCTAGCAGCTGG - Intergenic
973982226 4:56316140-56316162 GATGCAGGGCCGCCTGCAGCGGG + Exonic
974088144 4:57282780-57282802 GATGCTGGGACTCCAGCTGCTGG + Intergenic
976689662 4:87855561-87855583 GTTTCTGGGCTGCCAGCATCTGG - Intergenic
977102657 4:92837007-92837029 CCTTCTGTGCAGCCAGCAGCAGG - Intronic
981013620 4:139951411-139951433 ACTGGTGGGCCTCCAGAAGCAGG - Intronic
981297375 4:143147341-143147363 GCTGCTTTGGTGCCAGCAGCAGG - Intergenic
981334934 4:143559452-143559474 TCTGCTGGGCCGCCGTCTGCGGG - Intergenic
985786068 5:1895610-1895632 GCTGCTGGGTCCCTTGCAGCTGG + Intergenic
985896397 5:2751929-2751951 GCTGCAGGTCCGCGAGCCGCGGG - Intergenic
986348623 5:6856904-6856926 GCTGCTGTCCTGCCAACAGCTGG - Intergenic
988053876 5:26066460-26066482 GCACCTCGGCCACCAGCAGCAGG - Intergenic
989169402 5:38459754-38459776 GCTGCTGGGCCCCCAACCCCTGG + Intronic
990611087 5:57457620-57457642 GCTTCTAGGGCACCAGCAGCTGG - Intergenic
993872369 5:93267846-93267868 CCTGCTGGGCACCCAGCTGCTGG + Intergenic
994153391 5:96475057-96475079 GCTACTGGGCCAAAAGCAGCAGG + Intergenic
997292631 5:132748278-132748300 ACTCCTGGTCCCCCAGCAGCAGG - Intronic
997767538 5:136519959-136519981 GCTTCTTGGCCACCAGCAGCAGG + Intergenic
998040432 5:138947969-138947991 CCTGCCGGGCTACCAGCAGCGGG + Intronic
998692142 5:144598807-144598829 GCACCAGGGCCGGCAGCAGCGGG + Intergenic
998987961 5:147782820-147782842 GCTGCTGGCCCGGCAGCTGCTGG + Intronic
999188446 5:149730182-149730204 GCCGCAGGGCCGCTAGCTGCGGG - Intergenic
999666413 5:153917419-153917441 GCTGCTTGGCCCCCAGCTTCAGG + Intergenic
1001028501 5:168244535-168244557 GCTGCTGGGCAGCCAGAGGAAGG - Exonic
1002159585 5:177307414-177307436 CCTGCCTGGCAGCCAGCAGCAGG + Exonic
1002252608 5:177939059-177939081 GCTGCTGGGGAGCCTGGAGCTGG + Intergenic
1002296964 5:178237091-178237113 GCTGCTGGGCAGGCTGAAGCGGG - Intergenic
1002485260 5:179530702-179530724 AGCGCTGGGCCGCCCGCAGCCGG - Intergenic
1002505977 5:179679376-179679398 GCTCCTCGGTGGCCAGCAGCTGG - Intronic
1002546957 5:179955156-179955178 GCTGCAGCACCCCCAGCAGCAGG - Exonic
1002757818 6:178479-178501 GCTGCAGGGCGGATAGCAGCCGG + Intergenic
1002884484 6:1281483-1281505 CCTCCTGGACCCCCAGCAGCAGG - Intergenic
1003405190 6:5822083-5822105 GCTGCTGGAACCCCAGCAGGAGG + Intergenic
1004864396 6:19838336-19838358 TCCCCCGGGCCGCCAGCAGCCGG + Intronic
1007375498 6:41453408-41453430 GCTGCAGGGACGCCAGCTCCTGG + Intergenic
1007473539 6:42105370-42105392 TCTGCCTGGCCGCCAGGAGCAGG + Exonic
1007558013 6:42782795-42782817 GCGGCGGGGCCGCGAGCAGGGGG + Intronic
1013599659 6:111692332-111692354 GCAGCTGGGCAGCCGGCAGAAGG + Intronic
1014474928 6:121860372-121860394 GCCCCAGGGCCCCCAGCAGCAGG - Intergenic
1016461579 6:144285031-144285053 GTTGCTGGGCCGGCGGCGGCGGG + Intergenic
1018299753 6:162388780-162388802 TCTGCTGGGATGCCAGCATCTGG + Intronic
1018400217 6:163414305-163414327 GCTGCGGGGCCGACGGCCGCGGG - Intronic
1018613462 6:165663532-165663554 GCTGCTGGCCCGCTACCAGGAGG - Intronic
1018728048 6:166628159-166628181 GCGGCGCTGCCGCCAGCAGCGGG - Intronic
1019169447 6:170123970-170123992 GCTGCTGTGGTGCCAGCAGCAGG - Intergenic
1019281797 7:204274-204296 GCTGCTGGCCCGCCTGAGGCTGG + Intronic
1019436787 7:1026324-1026346 GCTGTTGCGCGCCCAGCAGCTGG - Intronic
1019641339 7:2105397-2105419 TCTGCTGGCCTGGCAGCAGCAGG + Intronic
1020009719 7:4801470-4801492 GCTGCTCAGCCCCCAGCAGCTGG - Intronic
1020658626 7:10956264-10956286 GTTGCACGGCAGCCAGCAGCTGG - Intergenic
1021845280 7:24757403-24757425 GCTGCCGGGGACCCAGCAGCGGG - Intronic
1022094477 7:27130298-27130320 GCTGCAGGGGCGGCGGCAGCTGG + Exonic
1022102607 7:27177449-27177471 GCAGCCGGCCCGCCTGCAGCCGG - Intronic
1022506986 7:30913596-30913618 TCTCCTGGGCTGCCAGCCGCAGG - Intronic
1023315585 7:38932734-38932756 GCTGCTAGGCAGCCAACAGGGGG + Intergenic
1023354565 7:39354024-39354046 CCTGCCGGGCCGCCTGGAGCGGG - Intronic
1023382588 7:39623581-39623603 GCTGCAGAGCCGCCAGGAGGAGG + Exonic
1023834179 7:44058811-44058833 GCTACTGGGCCGACAGCTGGAGG + Intronic
1023845302 7:44116942-44116964 CCTGCTGGGCACCCAGCTGCTGG - Exonic
1025235090 7:57228905-57228927 GCTGCTGTGTGTCCAGCAGCTGG - Intergenic
1025992261 7:66505068-66505090 GCTGCCTGGCCGGCAGCCGCGGG + Intergenic
1028398853 7:90403343-90403365 TCCACTGGGCCGCCAGCCGCAGG - Intronic
1029403497 7:100359349-100359371 GCTGCTGGGCCTCCAGGTGGTGG - Exonic
1029595506 7:101535563-101535585 GCTCCATGGCCTCCAGCAGCAGG + Intronic
1029737477 7:102472771-102472793 CCTGCAGGGCTGCCGGCAGCAGG - Exonic
1031093399 7:117389867-117389889 GTTTATGGGCAGCCAGCAGCTGG + Intronic
1031964565 7:128018348-128018370 TGTGCTGGGCTGTCAGCAGCTGG - Intronic
1032096029 7:128938930-128938952 GGTGCTGCTCCTCCAGCAGCAGG + Intronic
1032257139 7:130306259-130306281 GCTGCTGGGAGGGCAGCAGGAGG + Intronic
1032425612 7:131820068-131820090 GGTGCTTGGCTGCCAGGAGCTGG + Intergenic
1032781199 7:135166524-135166546 GCTGCTGGGCCGCCCGCCTGTGG - Exonic
1033597793 7:142868997-142869019 GCTGCATGGCCACCAGCTGCAGG - Exonic
1034262364 7:149764980-149765002 GCACCTGGGCCGCCACCAGGCGG - Exonic
1034276109 7:149824533-149824555 GCTGCTCTGAAGCCAGCAGCGGG - Intergenic
1034497423 7:151431151-151431173 GCTGGAGGGCTGCCGGCAGCAGG + Intronic
1035901801 8:3465133-3465155 GCTGCTGGGGCCTCACCAGCAGG + Intronic
1036210306 8:6835442-6835464 TCTGCTCGGCCGCCTGCAGCAGG + Exonic
1037936992 8:22921569-22921591 GCCGCTGAGCCCCCAGCACCTGG + Intronic
1038017767 8:23529456-23529478 GCCTCAGCGCCGCCAGCAGCCGG - Intronic
1038566239 8:28622474-28622496 GCTGCGGGGCCGCGAGAAGGCGG + Intronic
1039905306 8:41781906-41781928 GCAGGGGAGCCGCCAGCAGCAGG - Intronic
1039976484 8:42370869-42370891 GGAGCTGGGCCGCATGCAGCTGG + Intronic
1040122502 8:43698899-43698921 GCTGCAGGGACCCCATCAGCTGG + Intergenic
1041689848 8:60678520-60678542 GCTGCTGGGCCGCGGGCCGCGGG - Intergenic
1042928466 8:73990507-73990529 GCTGCTGGTCTGACAGGAGCTGG - Intergenic
1045674185 8:104589415-104589437 GCCCCTGGGCATCCAGCAGCCGG - Intergenic
1048269819 8:133019604-133019626 GGTGCCTGGCTGCCAGCAGCTGG - Exonic
1048306280 8:133286972-133286994 GATGGTGGACCGCCAGCAGCTGG - Intronic
1049099212 8:140567358-140567380 GCGTCTGGGCTGCCAGCAGCAGG + Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1049300375 8:141866580-141866602 CCTCCTGGGCCACCAGCAGGAGG + Intergenic
1049510612 8:143025000-143025022 GCTGCTGGGCGGCCAGGCGGGGG + Intergenic
1049598719 8:143497388-143497410 GCAGCTGGGTGGGCAGCAGCAGG + Intronic
1049721106 8:144115958-144115980 GCGGCTTGGCCTCCTGCAGCCGG - Exonic
1049838259 8:144754243-144754265 GCAGCTGGGCCCCCAGCAGCGGG - Exonic
1053381195 9:37650848-37650870 GCTGCGCGGCCGCCAGCTGCCGG - Intronic
1053418349 9:37960971-37960993 GCTGCTGGTCTGGCAGGAGCTGG + Intronic
1053646431 9:40122361-40122383 GCAGCAGGGCCTTCAGCAGCAGG - Intergenic
1053759282 9:41341190-41341212 GCAGCAGGGCCTTCAGCAGCAGG + Intergenic
1054327443 9:63720263-63720285 GCAGCAGGGCCTTCAGCAGCAGG - Intergenic
1054538138 9:66253612-66253634 GCAGCAGGGCCTTCAGCAGCAGG + Intergenic
1054914213 9:70480831-70480853 GCTGCCGCGGCGGCAGCAGCAGG - Intergenic
1056756009 9:89382566-89382588 GCTGCTGTGAGGCCAGCGGCGGG - Intronic
1056877623 9:90349727-90349749 CCTGCTTGGCCATCAGCAGCAGG - Intergenic
1057042487 9:91857668-91857690 TCTTCTGGGCCGGCAGGAGCAGG + Intronic
1057261334 9:93586483-93586505 GCTGCTGGCCCTCCCCCAGCTGG - Intronic
1058486524 9:105447822-105447844 GCCACTGGGCATCCAGCAGCCGG - Intronic
1059747204 9:117214577-117214599 GCTGCTGGGTCCCCAGGCGCGGG - Exonic
1060927541 9:127465545-127465567 GCTGTTGGGCCCTCAGCATCTGG + Intronic
1061105075 9:128523714-128523736 GCTGCAGCTCAGCCAGCAGCTGG + Exonic
1061203680 9:129151073-129151095 GCCGCTGGGGTGCCAGCAGCAGG - Intergenic
1061487939 9:130929716-130929738 GCTGGTGGGCGACCAGGAGCAGG - Exonic
1061609881 9:131739549-131739571 GCTGCGGGGGCGCCAGGGGCCGG - Intronic
1061812093 9:133168063-133168085 GTTCCTGGGCCCCCAGCACCTGG + Intergenic
1061836256 9:133332072-133332094 GCTTCAGGGCCTCCTGCAGCAGG + Exonic
1061837930 9:133341582-133341604 GCTCCGGGGACGCCAGCAGAGGG + Exonic
1062077483 9:134598755-134598777 ACGGCTGGGGCGCCAGCAGATGG - Intergenic
1062190533 9:135245697-135245719 GCGCCTGGGCCACCAGAAGCCGG - Intergenic
1062346241 9:136116582-136116604 GCTGCTGGGCCGCCGGCGCGTGG - Exonic
1062400442 9:136370353-136370375 GCTGCGGGACCACCAGGAGCAGG - Exonic
1062482060 9:136757102-136757124 GCTTCGGGGCCGTCAGCACCAGG + Exonic
1202794219 9_KI270719v1_random:105792-105814 GCGGCAGGGCCTTCAGCAGCAGG - Intergenic
1185759347 X:2677926-2677948 GCTGCCGGGTGGCCAGGAGCAGG + Intergenic
1186411685 X:9349638-9349660 ACTGGTCGGCAGCCAGCAGCGGG - Intergenic
1186457074 X:9718128-9718150 GCTGCTGGGTCACCAGCAGTGGG + Exonic
1186512254 X:10138912-10138934 GCCGCTCGGCCTCCCGCAGCAGG - Exonic
1190598773 X:52069191-52069213 GCTGCTGTGCTGGCAGCAGTAGG - Exonic
1190610051 X:52184882-52184904 GCTGCTGTGCTGGCAGCAGTAGG + Exonic
1190900869 X:54672028-54672050 GCTGATGGGAAGCCAGCATCTGG - Intergenic
1191058195 X:56265675-56265697 GCTGCAGGGCCCCCATCTGCAGG - Exonic
1191220770 X:57985743-57985765 GCTGCAGGGCAGCCTCCAGCTGG - Intergenic
1192497640 X:71626779-71626801 GCTGCTGGGCTTCCAGGAACAGG + Intergenic
1194088436 X:89557330-89557352 GCACCTGGGCCACCAGCTGCAGG + Intergenic
1197873877 X:131084259-131084281 GCTGCAGGGTCTGCAGCAGCAGG - Exonic
1198286196 X:135194432-135194454 GCAGCAGGGCCCACAGCAGCAGG - Intergenic
1198286229 X:135194568-135194590 GCAGCAGGGCCCACAGCAGCAGG - Intergenic
1198286233 X:135194583-135194605 GCAGCAGGGCCCACAGCAGCAGG - Intergenic
1198312608 X:135436553-135436575 GCTGCAGGGCCGCCTGGTGCTGG + Intergenic
1200081830 X:153580840-153580862 GCTGCAGGGCCGCTTGCAGGCGG - Exonic
1200097075 X:153669446-153669468 CCTGCTGGGCTGCCAGCAGGGGG - Intergenic
1200235304 X:154465146-154465168 GGTGCAGGGGCGGCAGCAGCGGG + Exonic
1200235774 X:154467087-154467109 GCTCCTGGACCGTCAGCAGGTGG - Exonic
1200242906 X:154507107-154507129 CCTGCTGGGGCGTGAGCAGCTGG + Intronic
1200441112 Y:3213369-3213391 GCACCTGGGCCACCAGCTGCAGG + Intergenic
1200714245 Y:6520057-6520079 GCTGCTGGGGCGAGGGCAGCGGG - Intergenic
1201019577 Y:9641100-9641122 GCTGCTGGGGCGAGGGCAGCGGG + Intergenic
1201143330 Y:11046672-11046694 GCTGGTAAGCCCCCAGCAGCTGG + Intergenic
1201730107 Y:17193435-17193457 GCTTCAGGGCCTCCTGCAGCAGG - Intergenic