ID: 921873345

View in Genome Browser
Species Human (GRCh38)
Location 1:220166393-220166415
Sequence GACCTCCTTAGTCAGTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921873345_921873349 3 Left 921873345 1:220166393-220166415 CCAGGGAACTGACTAAGGAGGTC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 921873349 1:220166419-220166441 GTGAAGGACTGATTGGCAAAGGG 0: 1
1: 0
2: 1
3: 15
4: 194
921873345_921873347 -4 Left 921873345 1:220166393-220166415 CCAGGGAACTGACTAAGGAGGTC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 921873347 1:220166412-220166434 GGTCTAAGTGAAGGACTGATTGG 0: 1
1: 0
2: 0
3: 10
4: 98
921873345_921873348 2 Left 921873345 1:220166393-220166415 CCAGGGAACTGACTAAGGAGGTC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 921873348 1:220166418-220166440 AGTGAAGGACTGATTGGCAAAGG 0: 1
1: 0
2: 0
3: 22
4: 183
921873345_921873350 4 Left 921873345 1:220166393-220166415 CCAGGGAACTGACTAAGGAGGTC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 921873350 1:220166420-220166442 TGAAGGACTGATTGGCAAAGGGG 0: 1
1: 0
2: 0
3: 15
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921873345 Original CRISPR GACCTCCTTAGTCAGTTCCC TGG (reversed) Intronic