ID: 921873347

View in Genome Browser
Species Human (GRCh38)
Location 1:220166412-220166434
Sequence GGTCTAAGTGAAGGACTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921873345_921873347 -4 Left 921873345 1:220166393-220166415 CCAGGGAACTGACTAAGGAGGTC 0: 1
1: 0
2: 0
3: 11
4: 144
Right 921873347 1:220166412-220166434 GGTCTAAGTGAAGGACTGATTGG 0: 1
1: 0
2: 0
3: 10
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921873347 Original CRISPR GGTCTAAGTGAAGGACTGAT TGG Intronic