ID: 921877197

View in Genome Browser
Species Human (GRCh38)
Location 1:220211143-220211165
Sequence GTAAAACTCCACCACTGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921877195_921877197 9 Left 921877195 1:220211111-220211133 CCAGTTTTATTTGATGCATAAGT 0: 1
1: 0
2: 1
3: 26
4: 234
Right 921877197 1:220211143-220211165 GTAAAACTCCACCACTGGTAAGG 0: 1
1: 0
2: 1
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921877197 Original CRISPR GTAAAACTCCACCACTGGTA AGG Intronic
900401652 1:2475252-2475274 GCCAAACTCCTCCCCTGGTATGG + Intronic
921877197 1:220211143-220211165 GTAAAACTCCACCACTGGTAAGG + Intronic
1063900071 10:10723621-10723643 ACATAACTCCACCACTTGTATGG + Intergenic
1065243388 10:23731520-23731542 AAAAGACTCCACCACTGATATGG - Intronic
1069276000 10:66591644-66591666 TTAAAATTCCACCACAGGAAAGG - Intronic
1070163411 10:73880020-73880042 GTAAAACTCCCACACTTGCAGGG - Intergenic
1070574445 10:77666957-77666979 GTCAAACTCCACTCCTGGTTTGG + Intergenic
1071953125 10:90727744-90727766 GTAAAAGTCCACAACTGATATGG - Intergenic
1094166701 12:27450451-27450473 GTTAAAATCCAACACTAGTAAGG + Intergenic
1113936644 13:113998394-113998416 GTAAAATTCTGCCAATGGTAAGG + Intronic
1115553445 14:34525220-34525242 GTTATACTCCACCACTGTGAGGG - Intronic
1116370586 14:44125864-44125886 GTAAAACACCATCAATTGTATGG + Intergenic
1117235256 14:53767727-53767749 GTAAAACCACACTACTGGTTGGG + Intergenic
1131920948 15:97328090-97328112 CCAAAACACCACCATTGGTATGG + Intergenic
1142297352 16:89234190-89234212 GGAAAACCACACCACTGGTGGGG - Exonic
1147425174 17:40342745-40342767 ATAAAAATCCACCACTAGGAAGG - Intronic
1154105533 18:11519306-11519328 GTACAACTCCCCCAGTGTTAAGG - Intergenic
1161641558 19:5426877-5426899 GTACATCTCCCCCACTGGGAGGG - Intergenic
1168293171 19:55366950-55366972 GTAAAACCCCAGCTCTGGTGGGG - Intronic
927618255 2:24622618-24622640 GACAAAATCCAGCACTGGTAAGG - Intronic
933983326 2:87571246-87571268 GTAAAACTCTCCCACTGGGTGGG - Intergenic
936037763 2:109126532-109126554 CTAAAACTCTATCACTAGTATGG - Intergenic
936310522 2:111379548-111379570 GTAAAACTCTCCCACTGGGTGGG + Intergenic
940841530 2:158588081-158588103 GTAAAACTTCAACAATGGAATGG - Intronic
945056369 2:205872840-205872862 GCAACACTCCACCACTGGATGGG + Intergenic
1169789986 20:9399717-9399739 GTAAGTCTCCACCACTTGTTTGG + Intronic
949494649 3:4620198-4620220 GTAAAAATCCACACCTGGGATGG - Intronic
951059223 3:18185237-18185259 GTATAATGCAACCACTGGTATGG + Intronic
951243391 3:20312965-20312987 CTAACACTCTACCACTGGTCAGG + Intergenic
958114377 3:89196382-89196404 GTATATCTCTCCCACTGGTATGG + Intronic
961038364 3:123659491-123659513 GTAAAACTCCAACATTTTTAAGG + Intronic
961810485 3:129518991-129519013 GGAAAACTCTTCCACTGGTCTGG + Intronic
969195689 4:5562058-5562080 GTAAAACACAAGCACTTGTATGG + Intronic
970511567 4:16786893-16786915 GTCTAACTCCACCGGTGGTAGGG - Intronic
977853500 4:101859234-101859256 GTAAAACTTCACCTCTGAGAAGG - Intronic
977864179 4:102003277-102003299 GTAAAACTCAATCACTGTCATGG - Intronic
977869718 4:102077096-102077118 AGAAAACTCCAGGACTGGTAAGG + Intergenic
983271372 4:165566045-165566067 CTACTACTCCACCACAGGTATGG - Intergenic
984418170 4:179486961-179486983 TTAAAAATCCACCTCTGCTAAGG + Intergenic
984420483 4:179514846-179514868 GTAAAACTCCATCAGTGGACTGG + Intergenic
986441733 5:7788556-7788578 GGAAAACTCCTCCTCTGGTGTGG - Intronic
987136722 5:14906715-14906737 GTAAAATTTCAGCACCGGTATGG + Intergenic
988891618 5:35623637-35623659 CTATAACTCCCCCACTGGTCTGG - Intronic
1003812939 6:9804836-9804858 GTTAAACTCAACCACTTGGAGGG + Intronic
1007838319 6:44695017-44695039 CTAAAACTCCACCAGTGATTTGG + Intergenic
1008603303 6:53116636-53116658 GGAAAACTCCATGACTGCTAAGG + Intergenic
1008859433 6:56131501-56131523 GTAAAACTCAGCCTCTGGGAGGG + Intronic
1009686208 6:66960862-66960884 GTGAAACTCCATCTCTGCTAAGG + Intergenic
1016130803 6:140467213-140467235 GCAACACTCCACCACTGCTTGGG + Intergenic
1017655367 6:156622644-156622666 GTACAGCTCTACCACTGGTTAGG - Intergenic
1019819331 7:3229929-3229951 GGAAAATTCAACCACTGATATGG - Intergenic
1024497651 7:50066840-50066862 GTGAAACCCAGCCACTGGTAAGG - Intronic
1024692792 7:51820868-51820890 GGATTTCTCCACCACTGGTATGG + Intergenic
1029669547 7:102019684-102019706 GTACAACTCCACCACGGGAAGGG - Intronic
1037600640 8:20391041-20391063 GTAAAACCTCATCACTGGTCCGG - Intergenic
1037920431 8:22801839-22801861 TGAAAACTCCACCACTCTTAAGG + Intronic
1042347084 8:67738446-67738468 GTAAAACTCCAGAACAGCTATGG - Intronic
1044214304 8:89589939-89589961 CTAAAATTCAACCACTGATATGG - Intergenic
1059630087 9:116112448-116112470 GAAATAATCCACTACTGGTAGGG - Intergenic
1189150473 X:38701211-38701233 GAAAGACTCCACCACTGGTATGG + Intergenic
1191774686 X:64801183-64801205 GTAAAAGTCTCCCACTGTTATGG + Intergenic
1194922088 X:99779180-99779202 GTACCACACCACCACTGCTAGGG + Intergenic
1196456084 X:115892677-115892699 GTAGAACTCCAGCACTGGGAAGG + Intergenic
1201753750 Y:17464422-17464444 GTATAACTCCATCAATGCTATGG + Intergenic
1201847802 Y:18441563-18441585 GTATAACTCCATCAATGCTATGG - Intergenic