ID: 921879846

View in Genome Browser
Species Human (GRCh38)
Location 1:220243572-220243594
Sequence CTGAAAAAGTAGATGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 560}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921879846 Original CRISPR CTGAAAAAGTAGATGGAAGA TGG (reversed) Intronic
900040839 1:463033-463055 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
900062269 1:698009-698031 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
900805897 1:4768255-4768277 CTGAATCAGTGGATAGAAGAAGG + Intronic
901563305 1:10090511-10090533 CTGTAAAAGAGGAGGGAAGATGG + Intronic
901806192 1:11740133-11740155 CTGAAAGAGGAGCTGGAAGCAGG - Intronic
901881053 1:12194049-12194071 CTGAACAAGTGGATGAAGGAAGG - Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902698164 1:18154331-18154353 CTGAAAAAAAAGATGTAAAATGG - Intronic
903751837 1:25627642-25627664 TTGAAAAAGAAGATCAAAGATGG - Intronic
904679584 1:32219734-32219756 TTGCAACAGTAGATGGAAGAAGG + Intronic
904827640 1:33284635-33284657 CTGAAGAGTTAGTTGGAAGAAGG + Intronic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
906300849 1:44680590-44680612 CGGAAAAAGTAGTTAGGAGATGG + Intronic
906554283 1:46695615-46695637 CTGACACAGGAAATGGAAGAAGG - Intronic
907338752 1:53718587-53718609 CTGAAAAAGTAGACTCCAGAGGG + Intronic
908061919 1:60359719-60359741 CTGCAAAAGAAGGTTGAAGAAGG - Intergenic
908391416 1:63686913-63686935 ATGAAGAAGTGGATGGAAGAAGG - Intergenic
909382909 1:75021132-75021154 ATGAAAAAATACATGGAAAATGG - Intergenic
912083085 1:105962626-105962648 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
912108380 1:106309504-106309526 CAGAAAAAGCAGTTGTAAGAGGG + Intergenic
912879423 1:113394007-113394029 CTGACAAAGTCCATGGCAGAAGG + Intronic
913025855 1:114839372-114839394 CTGAAAAAGTATAAGGCAGTAGG + Intergenic
913216145 1:116622125-116622147 CTGGAAAAGTAGATGTAAAATGG - Intronic
913964258 1:143362151-143362173 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
914850192 1:151308453-151308475 AAGAAAAAGCAGATGGAAGGAGG + Intronic
915755813 1:158258139-158258161 CTGAAAAATTAGAAGGAAAGGGG - Exonic
916441086 1:164825293-164825315 GTGATAAAGTAGAGAGAAGAGGG - Intronic
916724987 1:167515521-167515543 CTGAAAAAATATATGCAAGATGG - Intronic
918219719 1:182425945-182425967 CTGAAAAAGAAAAAGAAAGAAGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918834914 1:189449828-189449850 CTGACAAAGAAAAGGGAAGAGGG + Intergenic
919421482 1:197374996-197375018 CTGAAATGGTAGGTGAAAGAGGG - Intronic
921539926 1:216400750-216400772 CTGAAAAATTAGAAGCCAGAAGG + Intronic
921879846 1:220243572-220243594 CTGAAAAAGTAGATGGAAGATGG - Intronic
922005500 1:221526637-221526659 CTGAGAAGGTAGTTGGAAAAGGG - Intergenic
922030844 1:221796165-221796187 TTGAAAAAGTTCATGGAAAATGG + Intergenic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922649590 1:227325981-227326003 CTGAAGAAGTGGTTGGAACAAGG - Intergenic
923263651 1:232291488-232291510 CTGAGAAGGAAGATGGAAGAAGG + Intergenic
923291027 1:232546353-232546375 CTGTGAAAGTAGATGAAAAATGG - Intronic
923515121 1:234690704-234690726 CTGAAAATTGATATGGAAGAAGG + Intergenic
923699695 1:236288159-236288181 CTGACAAAGAAGAGGGAAGATGG - Intergenic
923858194 1:237867070-237867092 ATGAAAGAGTAGATGGCACAAGG - Intergenic
924074775 1:240322609-240322631 GAGGAAAAGTAGTTGGAAGAGGG + Intronic
924189764 1:241538278-241538300 ATGAGAAAGCAGATAGAAGAAGG - Intronic
924435164 1:244033108-244033130 CTGAATAATTGCATGGAAGAGGG + Intergenic
924643162 1:245852685-245852707 ATGAAAAAGGAGGTGAAAGAGGG - Intronic
1063192215 10:3706563-3706585 CTGGAAAAGTGGATTCAAGACGG + Intergenic
1063255140 10:4319579-4319601 CTGAAAAAGAAAATGCATGAGGG - Intergenic
1063268408 10:4479493-4479515 CTGAAAAGGGAGATGGATGAGGG + Intergenic
1063549667 10:7018826-7018848 AAGAAAAAGTAGATTGAACATGG + Intergenic
1063639117 10:7813558-7813580 CTGAAAGAGCAGATGCAAGATGG + Intergenic
1064557660 10:16563530-16563552 CTGCAAAACTAGAAGGAGGAGGG + Intergenic
1064750037 10:18519279-18519301 GTGGAAAAGTGAATGGAAGAGGG - Intronic
1065187129 10:23179210-23179232 CTAAGAAAGTAGATGCAAAAAGG + Intergenic
1067808240 10:49407934-49407956 ATGAAAAAATGGATGGATGAAGG + Intergenic
1068543385 10:58320896-58320918 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1069322073 10:67184346-67184368 ATGTAAAAGGAGATGGAACATGG - Intronic
1070182322 10:74026135-74026157 TTGAAAAAGAAAAGGGAAGATGG + Intronic
1070384486 10:75912247-75912269 CAGAAACAGATGATGGAAGAAGG - Intronic
1070963089 10:80512580-80512602 CAGAAAAAGGACAGGGAAGAGGG - Intronic
1071377224 10:85019629-85019651 ATGAAAGAGTTGATAGAAGATGG - Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071465063 10:85932203-85932225 TTAAAAAAGTGGATGGAAGAAGG - Intronic
1071477849 10:86040087-86040109 CTGAAAAAGCAGAGTTAAGATGG + Intronic
1071580344 10:86763421-86763443 CTTAAAAAATAGAAGGAACATGG + Intronic
1071580979 10:86769979-86770001 GAGCAAAAGTAGTTGGAAGAGGG + Intronic
1073269473 10:102250058-102250080 CTGAAAAGGTAGATGGTAGTAGG - Intronic
1073794296 10:106971048-106971070 CTGTAAAAGTTGTTGGAAGCAGG - Intronic
1073873384 10:107892099-107892121 ATGAGAAAGTAGAAGGAAGCTGG - Intergenic
1074479761 10:113808688-113808710 CTGAAAAAGGAGATTGGATAAGG - Intergenic
1074563195 10:114552757-114552779 CTGCAAAAGTAAGTTGAAGAAGG + Intronic
1076556831 10:131329449-131329471 ATGAAAACGTAGGTGGAAGATGG + Intergenic
1076967112 11:99262-99284 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
1078371314 11:10748491-10748513 CTGAAAAAGTAGTGTCAAGAAGG - Intergenic
1079612974 11:22456121-22456143 TTCAAAAAGTAGATGAAAGTAGG - Intergenic
1079652879 11:22951763-22951785 CTGAGAAAGAAGAAAGAAGATGG - Intergenic
1079666284 11:23110464-23110486 CTGAAAGAGTAAGTGTAAGATGG - Intergenic
1079750487 11:24190816-24190838 CCACAAAAGTAGCTGGAAGAGGG - Intergenic
1079776794 11:24541515-24541537 CTGAAAATGAAGATGGTAAAAGG - Intronic
1079844092 11:25442435-25442457 CAGAAAAAGGAGATAGTAGAGGG + Intergenic
1079876906 11:25869988-25870010 ATGTAGAAGTTGATGGAAGATGG + Intergenic
1079972395 11:27051937-27051959 CAGTAAAAGTAGTTTGAAGAAGG - Intronic
1080916497 11:36665658-36665680 TTGAGAAAGCAGGTGGAAGAGGG - Intergenic
1081235509 11:40643024-40643046 CTTGAAAAGTAGAGTGAAGAAGG + Intronic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1081540001 11:44027565-44027587 CTGAAAAAGGGGAAAGAAGAAGG - Intergenic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1081941452 11:46945787-46945809 CTTACACAGTAGATGGGAGATGG + Intronic
1082857142 11:57818054-57818076 CAGAAAAGGTAGATGAAAGTGGG - Exonic
1083201209 11:61122161-61122183 TTGCAAAAGTAGAAGGTAGAAGG - Intronic
1083209017 11:61171080-61171102 CAGAAAAACTAGAGGGAAGCAGG + Intergenic
1083885107 11:65569609-65569631 TTGAAAAAGAACACGGAAGAGGG + Intergenic
1085186229 11:74578365-74578387 CTGAAGAGGAAGGTGGAAGAAGG + Intronic
1085335416 11:75690053-75690075 AAGAAGAAGTAGAAGGAAGAAGG - Intergenic
1085999637 11:81966442-81966464 CTGAACTTGAAGATGGAAGAAGG + Intergenic
1086268858 11:85035231-85035253 TTGAAACAGCAGATAGAAGATGG + Intronic
1087655758 11:100921022-100921044 CTGAAAAAGTAGAGGCACGAAGG - Intronic
1087693463 11:101348593-101348615 CTGAGAAAGTTGAGGGAGGAAGG + Intergenic
1087758453 11:102079630-102079652 ATGTAAAAGTAATTGGAAGAGGG - Intronic
1087982730 11:104636301-104636323 ATGCAAAACTAGAAGGAAGAAGG - Intergenic
1088041543 11:105390256-105390278 GTGAAAAAGAAAAGGGAAGATGG + Intergenic
1088356307 11:108947587-108947609 CTAATAAATTGGATGGAAGATGG - Intergenic
1088745688 11:112802091-112802113 CTGAAAATGTAGAGAGGAGATGG - Intergenic
1089560581 11:119341257-119341279 CTGAAAAAGCAGATGGAAAGGGG + Exonic
1090013155 11:123062515-123062537 CGGAAAAAGGAGGAGGAAGAGGG + Intronic
1090109743 11:123894067-123894089 ATGACAAAATAGCTGGAAGAAGG - Intergenic
1090619964 11:128551658-128551680 CTGAGAAAATACATGGAAAAGGG - Intronic
1090681711 11:129066223-129066245 CTTAAAAAGTAGATGGGATAAGG - Intronic
1091071721 11:132571059-132571081 CTAGAAGAGTAGGTGGAAGAAGG + Intronic
1093622742 12:21311923-21311945 CTCAAAAAGAAGAAAGAAGAAGG + Intronic
1094397066 12:30019052-30019074 CAGAAAAAGGAGATGAAAGGAGG + Intergenic
1095318947 12:40801961-40801983 AAAAAAAAGTAGATGGAAGATGG + Intronic
1095335006 12:41013254-41013276 CTGAGAAAGAAAAGGGAAGATGG + Intronic
1096378168 12:51131825-51131847 CAGAAAAAGGAGAGGAAAGAAGG - Intronic
1096547887 12:52353721-52353743 CTGAAGAAGCAGATGGCAGTGGG + Intergenic
1096835706 12:54349829-54349851 CTGAGAAAGGAGTTGGAAGTAGG - Intronic
1097801803 12:63922565-63922587 CTGGAAAAGTAGGTTGAAGTAGG - Intronic
1098847010 12:75550186-75550208 CTTAGAATTTAGATGGAAGAGGG - Intergenic
1099182924 12:79488280-79488302 CTTAAAAAGTAGAAGGAGGCCGG + Intergenic
1099739280 12:86610801-86610823 CTGTAAAAGTAAATGAGAGACGG + Intronic
1099821702 12:87719611-87719633 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1099950044 12:89291825-89291847 CTGAAGAAGGAGAAAGAAGAGGG + Intergenic
1100605453 12:96148765-96148787 CTGGAAAAATAGATGGAATGAGG + Intergenic
1100724359 12:97393519-97393541 CAGATACAGTAGATCGAAGAAGG - Intergenic
1100962578 12:99979589-99979611 CAGAAGAATTAGATGCAAGAGGG + Intronic
1101179875 12:102204376-102204398 CAGAAAAATTAGATTGTAGATGG + Intergenic
1101197911 12:102404510-102404532 CTGACTGAGTAGAAGGAAGATGG + Intronic
1101709492 12:107251609-107251631 TAGAAAAAGCAGACGGAAGAAGG - Intergenic
1102464546 12:113120763-113120785 AAGAAAAATCAGATGGAAGATGG - Intronic
1102616040 12:114155064-114155086 CTTAAAAGGTATATGGAAGAAGG + Intergenic
1102770274 12:115470299-115470321 CTGAAACAGATGGTGGAAGATGG - Intergenic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1104532111 12:129581652-129581674 AGGATAAAGCAGATGGAAGAAGG - Intronic
1104813973 12:131635343-131635365 ATGAGAAGGTAGATGGATGATGG - Intergenic
1105219879 13:18315602-18315624 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1106268199 13:28128789-28128811 CTGAAACAGTAAATAAAAGAAGG + Intergenic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106751307 13:32771654-32771676 TAGAAAAATTACATGGAAGATGG - Intronic
1106974203 13:35187228-35187250 CTCAAAAAGGAGCTGAAAGAAGG - Intronic
1107117478 13:36762532-36762554 CTGACAAAGAAAAGGGAAGATGG + Intergenic
1107838959 13:44436096-44436118 CTGAAAAAGAGGAGGGAAAAAGG + Intronic
1108265462 13:48702734-48702756 TTGAAAAAGAAGATTGAAGTGGG - Intronic
1108935389 13:55875356-55875378 CTCAAACTGAAGATGGAAGATGG - Intergenic
1109233951 13:59792784-59792806 CTGAAAAAGTAGGAGAATGAAGG - Intronic
1109272649 13:60271666-60271688 CTGAGAAACTAGATGCAAGATGG + Intergenic
1109888574 13:68576348-68576370 TTGATAAAGTAAATTGAAGATGG + Intergenic
1110047876 13:70854228-70854250 CTGAATAGGTAGAAAGAAGATGG - Intergenic
1110614000 13:77521165-77521187 CTGAAAAACAAGATGGATGCTGG - Intergenic
1111424426 13:88060547-88060569 CAGAAGAAGAAAATGGAAGAGGG - Intergenic
1111728112 13:92038850-92038872 ATTAAAAAGTAGATGAAAAATGG + Intronic
1112485829 13:99818728-99818750 CTGGAAAAGAACATGGAATAAGG - Intronic
1113119077 13:106906984-106907006 CAGACAAAATAGATGCAAGAGGG - Intergenic
1113222776 13:108124244-108124266 CTGACAAAGAGGAGGGAAGATGG - Intergenic
1113933215 13:113979423-113979445 CTGAAAAGGGGGATGGGAGAGGG + Intronic
1114488574 14:23080586-23080608 CTGAAAGAGTTTAAGGAAGAAGG - Exonic
1114737774 14:25060173-25060195 CAGAAAAAGTAGATGAAGGGTGG + Intergenic
1115296506 14:31833657-31833679 CTGAAAGACTGCATGGAAGAAGG - Intronic
1115734834 14:36314682-36314704 CTGGAAAAGCAGAAGTAAGAAGG - Exonic
1116287545 14:42991854-42991876 CTGAAAAACTGGATGAAATATGG + Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1117820114 14:59640096-59640118 CTGAAAGAGTTTATGTAAGATGG + Intronic
1118155195 14:63233457-63233479 CTGAAAAAATAATTGGAAGGGGG + Intronic
1118960720 14:70528320-70528342 CTAAAAAAGAAGATAGTAGATGG - Intronic
1119194142 14:72704543-72704565 CTGACATTGTAGGTGGAAGAAGG - Intronic
1119573029 14:75693119-75693141 CTGAAAGAGGAGAAGGAAGAAGG + Intronic
1120392635 14:83928311-83928333 GTGAACAAGTATATGGAAAAGGG + Intergenic
1120580097 14:86236510-86236532 CTGAAAAAGTAGTGGGGCGAGGG + Intergenic
1121997110 14:98611451-98611473 ATGCAAAAGTAACTGGAAGAAGG - Intergenic
1122407779 14:101510423-101510445 CTGAAACAAGAGAGGGAAGAGGG + Intergenic
1124216736 15:27813348-27813370 GTGAAGAAGTGGATGGAAGTGGG - Intronic
1125139849 15:36392806-36392828 GTAAAAAAGTACATGGAAGCAGG - Intergenic
1126052096 15:44695386-44695408 CTGACAAAGAAAAGGGAAGATGG - Intronic
1126337235 15:47599461-47599483 CTCAAAAAGTAGATGGAGTTTGG + Intronic
1126525887 15:49653880-49653902 AAGGAAAAATAGATGGAAGATGG + Exonic
1126755672 15:51922955-51922977 TGGTAAAAGTAGATGCAAGAGGG - Intronic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1126994566 15:54425975-54425997 CTGACAAAGAATTTGGAAGATGG - Intronic
1127249451 15:57215917-57215939 CAGAAAAGTAAGATGGAAGAGGG + Intronic
1127269997 15:57391839-57391861 CTGAATAAGGATATGGAATAAGG - Intronic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1128095596 15:64952009-64952031 AAGAAAAAGAAGATAGAAGATGG - Intronic
1128839685 15:70840168-70840190 ATGAAAAAGGAGATGCAAGATGG + Intronic
1129007431 15:72385607-72385629 CTGGAACATTAGATGGAATAGGG - Intergenic
1129368963 15:75076022-75076044 CAGAAAAAATGGAGGGAAGAAGG + Intronic
1130166480 15:81465990-81466012 CTAAAAAAGTAGGAAGAAGAGGG - Intergenic
1130999891 15:88931552-88931574 CTGAAAAACTAAGTGGATGATGG + Intergenic
1132085258 15:98903317-98903339 AGGAAAAAGTAGATGGAGGGTGG + Intronic
1132441062 15:101864573-101864595 CTGAAAAAGTAGAAGAGTGATGG + Intergenic
1132795492 16:1719441-1719463 TTGAAAAGGAAGATGTAAGAGGG + Intronic
1134325025 16:13199692-13199714 GTAGAAAAGTTGATGGAAGATGG + Intronic
1134555689 16:15162068-15162090 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1134916271 16:18073779-18073801 CTGAAAAAGAAAAAAGAAGAAGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1137882263 16:52062381-52062403 CTGGCAATGCAGATGGAAGAAGG - Intronic
1138649280 16:58449653-58449675 ATGAAGAATGAGATGGAAGAAGG + Intergenic
1138923858 16:61566959-61566981 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1138979955 16:62256042-62256064 CTGAAGATGGAAATGGAAGATGG - Intergenic
1139078691 16:63487022-63487044 GTAAAAAAGTATTTGGAAGAAGG - Intergenic
1139087002 16:63599026-63599048 CTGAAAGTGTAAATGGCAGAGGG - Intergenic
1141854832 16:86673856-86673878 ATGAATGAGTAGATGGATGAAGG - Intergenic
1142782073 17:2189211-2189233 CTGAAAAAGTGACGGGAAGAGGG - Intronic
1143936246 17:10487467-10487489 CTGAAAAAGCAGTTATAAGAGGG - Intergenic
1144104229 17:11971697-11971719 CTAAAGAAGGAGGTGGAAGATGG + Intergenic
1144452960 17:15396447-15396469 CTTAAAAAGTCAATGGAAAATGG + Intergenic
1146132925 17:30293975-30293997 CGGAATAAGAAGATGGAAGGTGG + Intergenic
1147745443 17:42691783-42691805 CTAGAAAAGCAGATGGAGGAAGG - Intronic
1148943634 17:51238545-51238567 TAGAAAAAGAAGATGGATGATGG + Intronic
1150112015 17:62509808-62509830 CTCACAAAGTAGAAGGCAGAAGG - Intronic
1151379845 17:73718137-73718159 GTGAAAAAGTAAAAGCAAGATGG - Intergenic
1151790014 17:76299280-76299302 TTGAAAATGTAGACGGAAGCAGG + Intronic
1151790604 17:76303336-76303358 TTGAAAATGTAGACGGAAGCAGG - Intronic
1153148677 18:2063845-2063867 TTGAAAAAGGAGAAGGAAAAAGG + Intergenic
1153320418 18:3768500-3768522 TTGAAAAAGGAGAAGGAAGGGGG + Intronic
1155261551 18:24047959-24047981 TTAAAAAAGTATATGAAAGAAGG + Intronic
1155530050 18:26757936-26757958 CTGACAAAGGAGAAGGAAAATGG - Intergenic
1155852945 18:30795126-30795148 TTGTAAAATTACATGGAAGAAGG + Intergenic
1155866387 18:30970995-30971017 TTAAAAAAGTATATGGAATATGG - Intergenic
1156580297 18:38367193-38367215 CTGAAAAAGGAGATAGATGAGGG + Intergenic
1157468957 18:47973135-47973157 AAGAATAAGTAGATGGGAGAAGG + Intergenic
1157595210 18:48859970-48859992 CTGAAAAAGTGGGTCGGAGACGG + Exonic
1157970961 18:52268240-52268262 CAGAAAAAGTAGATATAAAAGGG - Intergenic
1158060921 18:53340416-53340438 CTGCAAAAGAAGATGAAAGAAGG + Intronic
1158368100 18:56763244-56763266 CTGATAAAGAACATCGAAGAAGG - Intronic
1158803229 18:60938053-60938075 TTGAAAAAATGGATGGCAGAAGG - Intergenic
1159133292 18:64306222-64306244 GTGAATAAATAGATGGAAGGGGG + Intergenic
1159403284 18:67965237-67965259 CTGAGAAAGTATATTAAAGAAGG + Intergenic
1159658455 18:71061780-71061802 CTGAACAAGTATCTTGAAGATGG - Intergenic
1159802710 18:72920662-72920684 CTGAAAAAGTCAGTGCAAGATGG - Intergenic
1159895543 18:73992238-73992260 CTGAAAAAGCATAGGGATGAAGG + Intergenic
1159952064 18:74491895-74491917 CAGAAAATGTAGATGGAAGTGGG + Intergenic
1160643915 19:168885-168907 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
1162324598 19:9991662-9991684 CAGAAAAAGAAGATGAGAGAAGG + Intronic
1162368822 19:10266607-10266629 GTCAAAAAGTAGAGGGAAGGTGG - Intergenic
1162387963 19:10371688-10371710 CTGAAAAAGCACATTGCAGAGGG - Intronic
1164383848 19:27756973-27756995 CAGAAAAGGTAGATGAAAGTGGG - Intergenic
1164426946 19:28150085-28150107 TGGAAAAAGTAAATGTAAGAAGG - Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1164662060 19:29983292-29983314 AAGACAAAGTAGAAGGAAGATGG - Intronic
1164913080 19:32027862-32027884 CTGAAAATGCAGAAGGAACAGGG + Intergenic
1165182490 19:33984586-33984608 TTGAATAAGTAGATGTAATATGG + Intergenic
1165501306 19:36191704-36191726 ATGAACAAGTGAATGGAAGAGGG + Intronic
1167904759 19:52649852-52649874 CTCAAAAAGTATATGTAAGGAGG + Intronic
1168211647 19:54894979-54895001 TTGAAAAACTAAATGGAATAAGG + Intergenic
1202698029 1_KI270712v1_random:139642-139664 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
925112851 2:1351537-1351559 CTGAACAGGTAGAAGAAAGAGGG + Intronic
925700297 2:6630011-6630033 GTCAAAAAGTAGTTGGTAGAGGG + Intergenic
925847833 2:8049718-8049740 CTGAAAGAAGAGATGGATGAAGG - Intergenic
925882914 2:8368094-8368116 CTGAAAGAGAAGATGGATGAGGG - Intergenic
926491894 2:13534039-13534061 CTAAAAATGTAAATGGAAAATGG + Intergenic
926600791 2:14843649-14843671 CTGAAAGAGGAACTGGAAGAGGG + Intergenic
926841430 2:17084950-17084972 ATGGAGAAGTAGATGGGAGATGG - Intergenic
926898894 2:17727926-17727948 GTGAAAAAATATATGGCAGATGG - Intronic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
927060921 2:19418694-19418716 CTGAAAAATAATATGGAATATGG + Intergenic
927882223 2:26696872-26696894 CTGAACAAGTAGAAGGAGTAGGG - Intronic
928321616 2:30287915-30287937 CTGAAAATGGAGATGGAAGATGG - Intronic
928538250 2:32260696-32260718 TTGAAAAAGAAAAGGGAAGATGG - Intronic
928972328 2:37043223-37043245 CTGTAACAGGAGATGGAACATGG + Intronic
929446501 2:42005701-42005723 CTGGAAGAGATGATGGAAGAAGG + Intergenic
929747336 2:44672453-44672475 CTGCAAAAGTAAATTCAAGAGGG - Intronic
929792679 2:45035159-45035181 TTGAAAAACTAAATGGAATAAGG + Intergenic
930055905 2:47251814-47251836 CCCAAAAAGTTGAGGGAAGATGG - Intergenic
930225684 2:48790194-48790216 CAGACACAGCAGATGGAAGAAGG + Intergenic
930247879 2:49003605-49003627 ATGAACAAATAGATGGAAGCAGG + Intronic
930756336 2:54977268-54977290 CAGAAAAATTAGAAGGAAGTGGG - Intronic
931037101 2:58255822-58255844 GTTAAAAAATAAATGGAAGAAGG - Intergenic
932724199 2:74163979-74164001 CTGAAAAAGAAGAGCGAGGAAGG + Intronic
933270760 2:80230564-80230586 TTGAAAAAGCAGACGGAAAAGGG + Intronic
933329297 2:80876500-80876522 TTGAAAAACTAAATGGAATAAGG + Intergenic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
933815975 2:86069156-86069178 CTGAAAAAGTACTTGGGAAATGG + Intronic
933925192 2:87085594-87085616 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
934184168 2:89656914-89656936 CTGGAAAAGTAGATGTAAAATGG + Intergenic
934279283 2:91597422-91597444 ATGGAAAAGGAGAGGGAAGAAGG - Intergenic
934294456 2:91731052-91731074 CTGGAAAAGTAGATGTAAAATGG + Intergenic
935009787 2:99123086-99123108 CTGAAAAACTGGAGGTAAGAAGG - Intronic
935248155 2:101237253-101237275 AGGAAAAAGAAGAAGGAAGAAGG + Intronic
935897721 2:107755637-107755659 CTGGCCAAGAAGATGGAAGAAGG - Intergenic
936384432 2:112016100-112016122 CTGAAAAAGTAGAACAAAGTAGG - Intronic
936658476 2:114515723-114515745 CAGAAAAAGAAGAAGGAAAAGGG - Intronic
937703205 2:124887647-124887669 CTGAAAATGAGGATGAAAGAAGG + Intronic
937887962 2:126913235-126913257 ATGAAAAAGGAGAAGGATGATGG - Intergenic
938651825 2:133391120-133391142 CTCAGAAAGTAGATGGTAGTTGG - Intronic
938926833 2:136051072-136051094 TTTAAAAAGGAGAAGGAAGATGG - Intergenic
939304513 2:140393580-140393602 CTGAAATAGAAGATGGAAAATGG - Intronic
939857953 2:147383139-147383161 CTGAAATGGGAGAGGGAAGAAGG - Intergenic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
941047742 2:160695537-160695559 TTGAAAATGAAGATGGGAGAAGG + Intergenic
941336450 2:164250162-164250184 CTGTCAATGTAGATGGAATAGGG - Intergenic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
942259356 2:174142412-174142434 GTGATAAAGTAGATTGAAGCAGG - Intronic
942265846 2:174224800-174224822 TTGATAAAGTAAATTGAAGAGGG + Intronic
942877801 2:180823383-180823405 AGGAAAAAGTAGGTGGTAGATGG - Intergenic
943212550 2:184986965-184986987 CAGCAAAAGTAGCTGAAAGAGGG + Intergenic
943236853 2:185332753-185332775 GTGGAAAAGTAGACTGAAGAAGG + Intergenic
944355121 2:198778416-198778438 GGGAAAGAGAAGATGGAAGAGGG + Intergenic
944429797 2:199620657-199620679 TTTCAAAAGAAGATGGAAGAAGG - Intergenic
944903226 2:204236932-204236954 CTGACAAATTAGATAGAAGTGGG - Intergenic
944926487 2:204470467-204470489 TTGTAAAAGTAGATAGAAAAGGG + Intergenic
945394681 2:209304199-209304221 CTGAAAAACTAAATGGAATAAGG - Intergenic
947307891 2:228767308-228767330 CTGAAAAGCTAGATAGAGGAGGG - Intergenic
1168969976 20:1924377-1924399 CTGAATCAGCAGCTGGAAGAAGG - Intronic
1169045531 20:2531841-2531863 GTGAAGAAGAAGAAGGAAGAAGG + Intergenic
1169049848 20:2566693-2566715 TTGAAAAGGTAGAAAGAAGAAGG + Intronic
1169808390 20:9582934-9582956 CTCAAAAAATAAAAGGAAGAGGG - Intronic
1170053215 20:12170172-12170194 CTGAAAAAGTACATGATGGAGGG - Intergenic
1170290051 20:14758987-14759009 TTGAAAAAGGAGATAGAAAAAGG - Intronic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1172392689 20:34576601-34576623 TTTAAAAAAAAGATGGAAGAGGG - Intronic
1173277424 20:41596900-41596922 CCCAAAAAGTATATGTAAGAAGG + Intronic
1173740532 20:45397387-45397409 CAGACAAAGTAGATTTAAGAAGG - Intronic
1173764269 20:45592883-45592905 ATGAACAAGAAAATGGAAGAAGG - Intergenic
1173887422 20:46472637-46472659 CTGAAAAAGAAGAGGGATAAAGG + Intergenic
1175780018 20:61676406-61676428 CTGAAAAAGAAGGTGGATGGGGG + Intronic
1175825620 20:61934983-61935005 CCGCAAAGGAAGATGGAAGACGG - Intronic
1176994041 21:15533139-15533161 CTGAAGAAGTAAGTGGAAAATGG + Intergenic
1177697689 21:24594563-24594585 CTGAAAGAGTACATAGGAGATGG + Intergenic
1178758459 21:35376519-35376541 CTGAAAGAGTGGAAGGAAGCCGG - Intronic
1178897737 21:36573368-36573390 CTCAAAAAGTATATAGAAAAGGG + Intronic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1179483242 21:41691893-41691915 CTGAAGAAGAGGATGGATGAGGG + Intergenic
1179606197 21:42517048-42517070 CTGGACAAGGAGATGGAAGTAGG + Intronic
1180817484 22:18800492-18800514 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1181203673 22:21234814-21234836 CTGGAAAAGTAGATGTAAAATGG - Intergenic
1181884098 22:26005529-26005551 CTGAAAAGCAAGAAGGAAGATGG - Intronic
1182236217 22:28878933-28878955 CTCAAAAAGAAAAAGGAAGAAGG - Intergenic
1182679872 22:32070308-32070330 CAAAGAAAGTAGAAGGAAGAAGG - Intronic
1182740443 22:32563608-32563630 CTGGAAAAGTTGATGGATCAGGG + Intronic
1185106639 22:48874045-48874067 CTGAAAATGCAGATTGAAGAAGG - Intergenic
1185230835 22:49680506-49680528 CTAAAAAAGAAGAAGGAAGTTGG - Intergenic
1203223247 22_KI270731v1_random:60602-60624 CTGGAAAAGTAGATGTAAAATGG + Intergenic
1203267582 22_KI270734v1_random:26218-26240 CTGGAAAAGTAGATGTAAAATGG - Intergenic
949881236 3:8662579-8662601 ATGAAAAAGGAGAAGGAACAAGG + Intronic
950598566 3:14009277-14009299 CTGTAATAGGAGATGGAACACGG - Intronic
950892500 3:16416666-16416688 CTGAACAAGTCCATGGAAAAGGG + Intronic
950995120 3:17487472-17487494 ATGAAAAATTAGATGTTAGAAGG + Intronic
951618347 3:24573173-24573195 GAGAAAAAATACATGGAAGAAGG + Intergenic
952168187 3:30774932-30774954 CTGGAAAAGGAGATGGCAGGAGG + Intronic
953099642 3:39811370-39811392 ATTAAAAAGTCGAAGGAAGATGG + Intronic
953771761 3:45782909-45782931 CTGAAATAGAAGATGGAATGTGG - Intronic
954085867 3:48243429-48243451 CTCAAAGAGTGGATGGAAGGAGG - Intronic
954334097 3:49906111-49906133 CTGAAAGAGGAAATGGAAGTGGG + Intronic
954855491 3:53640542-53640564 CTGCAGAGGTAGATGGAATATGG + Intronic
955706579 3:61733747-61733769 ATGAAACAGTAGAAGGAACAGGG - Intronic
956835461 3:73092777-73092799 CTCCAAAAGCAGATGGAAGTTGG - Intergenic
957144054 3:76398869-76398891 CTGAGTATGAAGATGGAAGAAGG + Intronic
957582029 3:82086514-82086536 CAGTAAAAGTAGATGAATGATGG + Intergenic
957651811 3:83016295-83016317 CTGAAAAATTAGAAGTACGAAGG - Intergenic
958489788 3:94757716-94757738 CTGAAATAGTTGCTGGAAAAAGG - Intergenic
958742068 3:98086533-98086555 AAGAAACAGCAGATGGAAGAAGG + Intergenic
958868716 3:99532173-99532195 CTGAAAGAGTAAATGAAGGAAGG + Intergenic
959081039 3:101801448-101801470 ATGACAAAGTAGCTGGAAGAAGG - Exonic
959324112 3:104914188-104914210 CTGAATAAGCAGAGGCAAGAAGG + Intergenic
959363094 3:105419965-105419987 CTGGATATATAGATGGAAGACGG + Intronic
959463043 3:106650552-106650574 AAAAAAAAGCAGATGGAAGAAGG - Intergenic
960551943 3:118985746-118985768 CTGAAAGAGCAAATGGCAGAGGG - Intronic
960687614 3:120309913-120309935 GTGACAAAGAAAATGGAAGATGG + Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
961075445 3:123977755-123977777 CTGAAAATTTTGAGGGAAGATGG - Intronic
961308241 3:125974761-125974783 CTGAAAATTTTGAGGGAAGATGG + Intronic
961378081 3:126480265-126480287 CTGAAAAAGAAGATGGCACTGGG + Intergenic
961486272 3:127219212-127219234 CTGAAAAAGTAAAGCGAAAAGGG + Intergenic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
961800447 3:129444366-129444388 CTGATAAAGAAGCTGGAACAAGG - Intronic
961981719 3:131086415-131086437 CTGAAAAAATACATGGATGGAGG - Intronic
962462109 3:135623872-135623894 CTGAAAAAGCGCATGGCAGAGGG + Intergenic
963167101 3:142216119-142216141 CTTAAAAAGTATATGGCAGCAGG + Intronic
964069117 3:152610722-152610744 GTGACAAAGAAAATGGAAGAGGG - Intergenic
964984539 3:162723486-162723508 CTGAAAAACTAAACGGAATAAGG + Intergenic
964986626 3:162749296-162749318 CTGAAAAAAAGGATGGAAAAAGG - Intergenic
965167600 3:165215814-165215836 TTTAAAAACTAGAAGGAAGAAGG - Intergenic
965545482 3:169911292-169911314 CTGAAACATTTGATGAAAGATGG - Intergenic
965879324 3:173369877-173369899 TGCAAAAAGTAGATGAAAGATGG - Intergenic
966014168 3:175121019-175121041 CTTAAAAGGTAGATGCAAAAAGG - Intronic
966527195 3:180932049-180932071 CTTACAAAGTAAATGGAAGAAGG - Intronic
966770045 3:183495765-183495787 TTGAAAAAGAAAAGGGAAGAAGG + Intronic
968588604 4:1446488-1446510 GGGAAAAAGAAGATGGATGATGG + Intergenic
968882290 4:3307472-3307494 CTAAAAAAGTAAAAGTAAGAGGG - Intronic
969031472 4:4218471-4218493 ATGGAAAAGGAGAGGGAAGAAGG + Intronic
969389892 4:6884726-6884748 CTGTAACAGGAGATGGAACATGG - Intergenic
969922046 4:10549681-10549703 ATGAAAAATTAGAGGGAAAACGG + Intronic
970027996 4:11644376-11644398 ATGAAAAAGAAGAAGAAAGAAGG - Intergenic
971497700 4:27284706-27284728 CTCAAAAAGTAGATACAAGTAGG - Intergenic
972709663 4:41582312-41582334 ATGGAAAACTAGATGGAAGATGG + Intronic
973193441 4:47413000-47413022 GTGAAAAAGGAAAGGGAAGATGG + Intronic
973774633 4:54232406-54232428 CTGAAAAAGTAGATTGTAGGAGG + Intronic
974292090 4:59946147-59946169 TTGAATAAGAAGATGGAAGTAGG - Intergenic
974297732 4:60024265-60024287 CAGAAACAATAGATGCAAGAAGG - Intergenic
974694768 4:65352015-65352037 CTGTAACAGCAGATGGGAGACGG + Intronic
975526653 4:75358213-75358235 CAGAATAAGTAAATGGAAGTTGG - Intergenic
975608705 4:76182443-76182465 TTTAAAAAGTAGAAGGAAGCAGG - Intronic
976351563 4:84065903-84065925 CTGAAAAAGAAGAAGGTAGCAGG + Intergenic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977149282 4:93489234-93489256 CTGAAAAAATTGAAGGAAGACGG + Intronic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
978353020 4:107840414-107840436 GTGAAAATGTATATGGAGGAGGG - Intronic
978410916 4:108424455-108424477 CTCAAAAAGTAAAAGGATGAAGG + Intergenic
978609690 4:110523732-110523754 CAAAAAAAGGACATGGAAGAGGG + Intronic
978881539 4:113709132-113709154 CTTAAAAACTAAATGGAAAAAGG - Intronic
979847047 4:125527856-125527878 CTAATGAAGTAGATGGAAGTGGG - Intergenic
980160975 4:129162565-129162587 GTGAAAAAGTAGATGAAATATGG - Intergenic
980522375 4:133950602-133950624 CTCAAACTGAAGATGGAAGATGG - Intergenic
980792145 4:137633432-137633454 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
980971558 4:139572187-139572209 AAGAAGAAGAAGATGGAAGATGG - Intronic
981227487 4:142313803-142313825 GTGAAAAAGCAGAGGGAAAAGGG - Intronic
981669480 4:147271288-147271310 CTGCAAAAGTGGTTGTAAGAGGG - Intergenic
982475013 4:155839825-155839847 CAGAAAAAAAAGATGGTAGATGG + Intronic
982862536 4:160471155-160471177 CTGTAAACGTATCTGGAAGAGGG + Intergenic
982900219 4:160989489-160989511 CTTTAAAATTACATGGAAGAGGG - Intergenic
984112103 4:175629395-175629417 TGGAAACAGCAGATGGAAGATGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
984448643 4:179870503-179870525 ATGAAAAAGTAGAGAGAAAAAGG - Intergenic
986034725 5:3926651-3926673 CTGACAAAGAAGATGGAAAAGGG - Intergenic
987042081 5:14072394-14072416 GTGAAAATGGAGATAGAAGATGG - Intergenic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988657675 5:33229956-33229978 TTGAAAAAGATGATGGCAGATGG + Intergenic
988720830 5:33877604-33877626 GTGAAAATGTTGATGGGAGAAGG + Intronic
989561395 5:42856213-42856235 TTAAAAAAGTAGATTGAAGAGGG + Intronic
989673816 5:43950770-43950792 CTGAAAGAATAGAAGGAAGGAGG + Intergenic
989954690 5:50343855-50343877 CTGAAAAATCACAAGGAAGAGGG - Intergenic
990140277 5:52695249-52695271 CTGAGAAAGGAGATGAAGGAAGG - Intergenic
990708810 5:58560502-58560524 CTAAATAAGTAGGTGGATGATGG + Intergenic
991072957 5:62506251-62506273 CTGAAAAAGTAGTGTGAACATGG - Exonic
991508169 5:67347021-67347043 CAGCAAAAGTAGTTTGAAGAGGG + Intergenic
991748249 5:69769177-69769199 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991799829 5:70349022-70349044 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991828768 5:70661016-70661038 CTTAAAAAGGAGAAGGAAAAAGG + Intergenic
991892187 5:71348453-71348475 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991948139 5:71920898-71920920 CTGATAAAATAAATTGAAGAGGG + Intergenic
992013675 5:72555735-72555757 CTGAGAAAGCTAATGGAAGATGG - Intergenic
992923756 5:81558123-81558145 CTGTAACAGTATATGGCAGAAGG - Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993304551 5:86259209-86259231 CTGAATAAGTAGTTAGAATAAGG + Intergenic
993717607 5:91291274-91291296 CCCAAAAAGGGGATGGAAGAAGG - Intergenic
994002011 5:94791871-94791893 CTGAGAAAGGTGCTGGAAGAGGG - Intronic
994326327 5:98450566-98450588 CTGAAAAAAAAAATGGAAGCAGG + Intergenic
994549525 5:101213181-101213203 CAGAAAAAGCAGGTGGTAGAAGG + Intergenic
995262697 5:110123695-110123717 ATAAAAAAATAAATGGAAGATGG - Intergenic
995277414 5:110292866-110292888 CTGAAAAAGGAGGTGGAAATGGG + Intronic
995277689 5:110295496-110295518 TTGAAAAATTAGAGGGAAAAGGG - Intronic
996063045 5:119052860-119052882 GTGAAAATGTAGAAGGCAGAGGG + Intronic
996103899 5:119475958-119475980 CAGCAAAAGTAGATAGAAGCAGG - Intronic
996250032 5:121318089-121318111 CTGAAAAAGTAAAGGGATGGTGG + Intergenic
996794538 5:127330489-127330511 CTGGCAAAGGAGATTGAAGAGGG - Intronic
996876286 5:128243718-128243740 GTGAGTAAGTAGATGGATGATGG + Intergenic
997289375 5:132715756-132715778 CTGAAAAAGAAGCTTGAAGAAGG - Exonic
997653457 5:135538535-135538557 CTCAAAAAACAGATGGAACAAGG - Intergenic
998199238 5:140106913-140106935 CTGAATACGTAGATGGAACGTGG - Intergenic
999072795 5:148765349-148765371 ATGAGAAAGGAGAGGGAAGAGGG - Intergenic
999371982 5:151061335-151061357 GGGAAAATGTAGATGGAGGAGGG - Intronic
999945746 5:156593315-156593337 CTGAAAAATTACATTGAAGCAGG - Intronic
1000681940 5:164196045-164196067 CTGAAGAGGTAGAGAGAAGATGG - Intergenic
1000806557 5:165800584-165800606 CTGAAAAAGTAGAATAAAGCTGG + Intergenic
1002516241 5:179761091-179761113 CTCAAAAAAAAGATGGAAGGAGG + Intronic
1002733006 5:181355894-181355916 CTGAAAAAGTAGAAGAGTGATGG + Intergenic
1002751532 6:118210-118232 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
1003246479 6:4386370-4386392 CTCAAAAAGTGTATGTAAGAAGG + Intergenic
1003491213 6:6623553-6623575 GTGAAAAAGCAGAGGAAAGAGGG + Intronic
1004174408 6:13327138-13327160 CTGATAAAATAGATGGCACAAGG + Intronic
1005677008 6:28165036-28165058 GTGAGAAAGTGGGTGGAAGAGGG - Intergenic
1007096953 6:39219176-39219198 CGGGAAAAGTTGATGGAACAAGG + Intronic
1007215206 6:40231950-40231972 CTCACAAAGAAGATGGAAAAGGG + Intergenic
1007650793 6:43419625-43419647 CTGGAAAATTAGGTGGAAGAAGG + Intergenic
1008937792 6:57011391-57011413 ATGAAAATGTAGATGCAAGAAGG + Intronic
1009628427 6:66165411-66165433 CTCAAAAAGTATATATAAGAAGG - Intergenic
1011164752 6:84433363-84433385 TTGAAAAGGTATGTGGAAGAGGG - Intergenic
1011338654 6:86287671-86287693 CTTAAAGATTAGAAGGAAGATGG - Intergenic
1011676517 6:89739708-89739730 CTGATAAAGTAAAGGGCAGAGGG - Intronic
1012468679 6:99545398-99545420 CTGAAAAATGAGATGCTAGAAGG - Intronic
1012745195 6:103078107-103078129 CTGTCAAAGGAGATGGAAAATGG - Intergenic
1013927326 6:115488962-115488984 CTCAAAAAGGAGATAGAATAGGG - Intergenic
1014042846 6:116849879-116849901 TAGAAAAAGCAGGTGGAAGAAGG + Intergenic
1014057670 6:117035234-117035256 CTGAAGAAGTAGGTGCAAGTTGG - Intergenic
1014397928 6:120949438-120949460 CTGAAGAAGTAGATGCAATGAGG - Intergenic
1015104089 6:129516167-129516189 CTGAAAAAGGCAATGCAAGAGGG - Intronic
1015983733 6:138865034-138865056 TCGCAGAAGTAGATGGAAGAGGG - Exonic
1016086971 6:139926367-139926389 CACAAAACGCAGATGGAAGAGGG - Intergenic
1016447261 6:144146882-144146904 CTGAAAAAGTAAATTGTGGATGG + Intergenic
1016447350 6:144147703-144147725 CTGAAAAAGTAAATTGTGGATGG - Intergenic
1016924635 6:149331062-149331084 CTGAAAAAGGAGAATGAAGTTGG - Intronic
1017545650 6:155448713-155448735 CTGAAAAATAAAATGAAAGAAGG - Intronic
1018614431 6:165673180-165673202 CAGATAAACTAGATGGAAGAAGG + Intronic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019131211 6:169877433-169877455 CTAAAAAGGAAGACGGAAGAAGG - Intergenic
1019237258 6:170628211-170628233 CTGAAAAAGTAGAAGAGTGATGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019940755 7:4287770-4287792 CTGAAAAAGAAGAGTGAAGTGGG - Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1020967469 7:14889506-14889528 CTTGAAAAGGAGATGGGAGATGG + Intronic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1024879393 7:54068552-54068574 CTTAAAAAATAAATAGAAGATGG + Intergenic
1026857868 7:73766869-73766891 CGGAAACACTAGATGGAAAAGGG - Intergenic
1027479723 7:78680797-78680819 CTGAAAGACTATATGGAAGAAGG - Intronic
1028311128 7:89337249-89337271 ATGAAAGCGTAGAGGGAAGAGGG + Intergenic
1028871765 7:95778205-95778227 GTGAAAATGGAGATGGAAAAAGG + Intronic
1030448422 7:109677070-109677092 TTGAAAAATTATTTGGAAGAGGG - Intergenic
1030492025 7:110249125-110249147 CTGAAAAAGTATGTAGAAGCTGG + Intergenic
1030769192 7:113452668-113452690 GTGAAAAAGAAGAGGGAAAATGG + Intergenic
1031096801 7:117429724-117429746 CTGAAAAAGAAGAATAAAGAAGG + Intergenic
1032041210 7:128563718-128563740 CTCACAAAGTAGAAGGCAGAAGG - Intergenic
1032310684 7:130783947-130783969 CTGAAATAGAAGATAGAAGATGG - Intergenic
1032360247 7:131248744-131248766 AGGAAAAAGTGGATGGAACAGGG + Intronic
1032662283 7:133998112-133998134 TTGAAAAAGTAGAGGGAAACAGG + Intronic
1032675017 7:134121851-134121873 CTGAAAGAGGAGAAGGAAGTGGG - Intergenic
1033356833 7:140607122-140607144 CTGAAGAAGGAGTTGGGAGAGGG - Intronic
1033801575 7:144908332-144908354 TTGAAAAAGTCAATGCAAGATGG + Intergenic
1034620866 7:152456124-152456146 AAGAAAAATTACATGGAAGATGG + Intergenic
1034623532 7:152474847-152474869 ATGAGGAAGTAGATGGAGGAGGG + Intergenic
1034854145 7:154524768-154524790 CGGAAAAATTAGATGGAAAAGGG + Intronic
1035279104 7:157766116-157766138 ATGGATAAGTAGATGGATGATGG - Intronic
1035288608 7:157822611-157822633 ATGAAAGGGTAGATGGATGATGG - Intronic
1035510510 8:178396-178418 CTGAAAAAGTAGAAGAGTGATGG - Intergenic
1035646567 8:1226615-1226637 CTGAAAAAATAAATGAAATATGG + Intergenic
1036275799 8:7350638-7350660 CTGAAACACCAGATGGCAGAAGG - Intergenic
1036345556 8:7959720-7959742 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036840883 8:12120474-12120496 CTGAAACACCAGATGGCAGAAGG + Intergenic
1036862690 8:12366724-12366746 CTGAAACACCAGATGGCAGAAGG + Intergenic
1037068238 8:14610234-14610256 GAGAAACAGTAGATGTAAGAAGG + Intronic
1037090792 8:14915533-14915555 CTGACAAAGAGGAGGGAAGATGG - Intronic
1037924354 8:22832886-22832908 CTGATAAAGGAGATGGGTGAGGG - Intronic
1038125789 8:24671408-24671430 CTGAGAAAGCAGATGTGAGAAGG + Intergenic
1039181463 8:34871544-34871566 CTGAAAAAATAGCTAGAAGGAGG - Intergenic
1039690658 8:39861450-39861472 GTGAAAAAGTATCTGGAAGCAGG - Intergenic
1039703190 8:39981781-39981803 ATGAAAATGGAGATGGAAGAGGG + Intronic
1040606478 8:48937842-48937864 TTTAAAAAGTAGATGAAATAAGG - Intergenic
1040779623 8:51092706-51092728 GTGACAAAGTAAAGGGAAGATGG - Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1041635100 8:60134039-60134061 ATTAAAAAATAGATTGAAGAGGG + Intergenic
1041734933 8:61100023-61100045 GTGAAAAGGGAGGTGGAAGATGG - Intronic
1041948518 8:63474244-63474266 CTGAAAAAGTAGATGAAACCAGG + Intergenic
1042879752 8:73473880-73473902 AGAAAAAAGGAGATGGAAGAAGG + Intronic
1043029311 8:75112396-75112418 CAGCAAAAGTAGTTGTAAGAAGG - Intergenic
1043035964 8:75199689-75199711 CTGAAGAAGGAAATTGAAGAGGG - Intergenic
1043392447 8:79804743-79804765 CTGAAAAACTGTGTGGAAGATGG + Intergenic
1044460341 8:92437174-92437196 ATGACATAGTAGATGGAACACGG - Intergenic
1044817183 8:96125204-96125226 CTGAAAAGGGAGGTGGAAGAGGG + Intergenic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1045117157 8:98995205-98995227 CTGGGAAAGCATATGGAAGAAGG - Intergenic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045524433 8:102929834-102929856 CTGAAAGAGTAAAAGGAAAAAGG + Intronic
1047450940 8:124964511-124964533 CTGAAAAAAAAGATAGAAGGAGG + Intergenic
1047549953 8:125860108-125860130 ATGGAAAGGTAGATGGAAGCGGG + Intergenic
1047929167 8:129709421-129709443 CTCAAAAGGTAGATGATAGATGG + Intergenic
1047981526 8:130188184-130188206 CTGAAAAAGCAAAGGGAAGATGG + Intronic
1049047477 8:140164444-140164466 CTGAAGAGGAAGAAGGAAGAAGG - Intronic
1049629163 8:143642909-143642931 CTGAATGAGTAACTGGAAGAAGG - Intronic
1050993364 9:12181277-12181299 CTGAAAATGTAGATAGAAGTAGG - Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1051591766 9:18783297-18783319 TTTTAAAAGTAGATTGAAGAGGG + Intronic
1052586277 9:30432226-30432248 CTGATAAAATAAATTGAAGAGGG + Intergenic
1052721114 9:32172012-32172034 CTTACAAAATAGATGGAAGGCGG + Intergenic
1052885393 9:33642282-33642304 CTGAAAAAGTTTATGTAAGAAGG - Intergenic
1052959731 9:34285256-34285278 CTGGAAAAGGAAATGGAAGTGGG + Intronic
1053316540 9:37056745-37056767 CTTAAAAAGTGGAGGGGAGAGGG + Intergenic
1053487468 9:38470766-38470788 ATGAATAAGTGGATGGATGAAGG - Intergenic
1053576294 9:39359268-39359290 CTGGGAAAGAAGATTGAAGATGG - Exonic
1053589261 9:39494848-39494870 CTGAAAAAGTAATAGTAAGAAGG + Intergenic
1054097863 9:60917959-60917981 CTGGGAAAGAAGATTGAAGATGG - Intergenic
1054119265 9:61193589-61193611 CTGGGAAAGAAGATTGAAGATGG - Exonic
1054577037 9:66870445-66870467 CTGAAAAAGTAATAGTAAGAAGG - Intronic
1054588488 9:66988973-66988995 CTGGGAAAGAAGATTGAAGATGG + Intergenic
1054850739 9:69843986-69844008 TTAAAAATGTAGATGGAAGAAGG - Intronic
1055483187 9:76730599-76730621 CTGAAATAAAAGATGAAAGAGGG + Intronic
1055955868 9:81773049-81773071 CTGAAGAGGTAGTTGGTAGAGGG + Intergenic
1056008147 9:82296114-82296136 GTGAAAAAGAGGATGGGAGAAGG - Intergenic
1056069115 9:82967576-82967598 ATGAAAAAGAAGATGGAGTAAGG - Intergenic
1056125574 9:83533996-83534018 AAAAAAAAGTAGATAGAAGATGG + Intronic
1056218455 9:84428012-84428034 ATGCAAAAGTAGAAGGAATAGGG + Intergenic
1056326433 9:85483248-85483270 TTTAAATAGTAAATGGAAGAAGG + Intergenic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1057073090 9:92117423-92117445 GTGACAAAGAAAATGGAAGATGG - Intergenic
1058096177 9:100862716-100862738 TAGAAAAAGCAGGTGGAAGACGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058904412 9:109470028-109470050 AAAAAAAAGTAGAGGGAAGAAGG - Intronic
1059256259 9:112934145-112934167 CTAACAAAGGAGGTGGAAGAGGG + Intergenic
1059647767 9:116284430-116284452 CTTAAAGAGTAGGTGAAAGAAGG - Intronic
1059855704 9:118395059-118395081 CTGAAATAGAAAATGCAAGAGGG - Intergenic
1060018871 9:120111242-120111264 AAGATAAAGTGGATGGAAGAAGG - Intergenic
1061077008 9:128347917-128347939 CTGAAAGGGGAGAGGGAAGAAGG + Intronic
1061244648 9:129395190-129395212 ATGAAAAAATGGATGGAGGATGG + Intergenic
1062757412 9:138308220-138308242 CTGAAAAAGTAGAAGAGTGATGG + Intergenic
1185713819 X:2325470-2325492 CTGACAAAGAGGAGGGAAGATGG - Intronic
1187028874 X:15465096-15465118 CTGCAAAAGTAGAGGAAAGGGGG - Intronic
1187255783 X:17640720-17640742 ATAAAAACTTAGATGGAAGAGGG - Intronic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1187779914 X:22808902-22808924 TTGAAGAAATAAATGGAAGAGGG + Intergenic
1188521122 X:31039129-31039151 GTGAAATAGTAGTTGGAAGCTGG + Intergenic
1188996009 X:36887102-36887124 TTGAAAAAATATATAGAAGAGGG + Intergenic
1189011528 X:37049953-37049975 CTAAAATAATAGATGGAACAAGG + Intergenic
1189237828 X:39501859-39501881 CTGAAAAAGAAAAAGGCAGAAGG + Intergenic
1189914896 X:45847365-45847387 CTTAAAAAATAAATGGAAGCTGG - Intergenic
1189990989 X:46594830-46594852 CTGAAAAAGTACTTGAAATATGG - Intronic
1192088401 X:68125789-68125811 CTGAAAAAATAGAGGGGGGAGGG + Intronic
1192459496 X:71304777-71304799 ATGAAAAGGGAGAAGGAAGAGGG - Intronic
1195501954 X:105612590-105612612 CTGAAAGAGGCGCTGGAAGAAGG + Intronic
1195716606 X:107825088-107825110 CTCAAAAGGTGGATGGGAGAGGG - Intergenic
1195920003 X:109974263-109974285 CTGAAAAAGTAGAAAGAAGATGG - Intergenic
1195999684 X:110768554-110768576 CAGAAAAAGCAGGTAGAAGAAGG + Intronic
1196583469 X:117402402-117402424 CTCAAAATGGAGAAGGAAGATGG - Intergenic
1197362234 X:125519217-125519239 CTGTGAAAGTACATGGAAGAAGG - Intergenic
1197633269 X:128886599-128886621 TAGAAAAAGCAGGTGGAAGAAGG - Intergenic
1198011838 X:132564330-132564352 CTAAACAAGCATATGGAAGACGG - Intergenic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198934639 X:141893966-141893988 CTAAAATACTAAATGGAAGAGGG + Intronic
1199195514 X:145025055-145025077 CTGTAAAAGTAAATGAAAGAAGG + Intergenic
1200107334 X:153722349-153722371 CTGGAAAAGCAAATGAAAGAGGG - Intronic
1200773022 Y:7144739-7144761 GTGAAAAAGAAAAGGGAAGATGG - Intergenic
1200838674 Y:7757803-7757825 CTGAACAAGTCCATGGAAAAGGG + Intergenic
1200885507 Y:8264455-8264477 CTGAAAAAGGAGACCGAAGCAGG - Intergenic
1201391180 Y:13499092-13499114 CTGAAAAGGTAGATGGAACGGGG - Intergenic
1201685999 Y:16703060-16703082 CTGAAAAAGCAGGCAGAAGAAGG - Intergenic
1201853967 Y:18520484-18520506 TTGAAAAAGCAGATTTAAGAAGG - Intergenic
1201879354 Y:18799900-18799922 TTGAAAAAGCAGATTTAAGAAGG + Intronic
1202018160 Y:20434334-20434356 CTCAAAAAGAAGATAGATGATGG - Intergenic
1202332211 Y:23766687-23766709 ATGAAAATATAGATGAAAGACGG + Intergenic
1202342344 Y:23882949-23882971 TTGAAAAAGCAGATTCAAGAAGG + Intergenic
1202528425 Y:25787136-25787158 TTGAAAAAGCAGATTCAAGAAGG - Intergenic
1202538558 Y:25903376-25903398 ATGAAAATATAGATGAAAGACGG - Intergenic