ID: 921884153

View in Genome Browser
Species Human (GRCh38)
Location 1:220287639-220287661
Sequence CAGTGAAAAGTGAAGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921884153_921884160 15 Left 921884153 1:220287639-220287661 CCATCCTCCTTCACTTTTCACTG No data
Right 921884160 1:220287677-220287699 TCCAGTGTTCTAGAACACTGGGG No data
921884153_921884159 14 Left 921884153 1:220287639-220287661 CCATCCTCCTTCACTTTTCACTG No data
Right 921884159 1:220287676-220287698 TTCCAGTGTTCTAGAACACTGGG No data
921884153_921884158 13 Left 921884153 1:220287639-220287661 CCATCCTCCTTCACTTTTCACTG No data
Right 921884158 1:220287675-220287697 GTTCCAGTGTTCTAGAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921884153 Original CRISPR CAGTGAAAAGTGAAGGAGGA TGG (reversed) Intergenic
No off target data available for this crispr