ID: 921888078

View in Genome Browser
Species Human (GRCh38)
Location 1:220326373-220326395
Sequence CTGTGCCTGATTCTTCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921888078_921888080 -7 Left 921888078 1:220326373-220326395 CCTGTGAGAAGAATCAGGCACAG No data
Right 921888080 1:220326389-220326411 GGCACAGTGGTCACATATTCTGG No data
921888078_921888081 17 Left 921888078 1:220326373-220326395 CCTGTGAGAAGAATCAGGCACAG No data
Right 921888081 1:220326413-220326435 TTCCCAGAATAGTCCCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921888078 Original CRISPR CTGTGCCTGATTCTTCTCAC AGG (reversed) Intergenic
No off target data available for this crispr