ID: 921888080

View in Genome Browser
Species Human (GRCh38)
Location 1:220326389-220326411
Sequence GGCACAGTGGTCACATATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921888078_921888080 -7 Left 921888078 1:220326373-220326395 CCTGTGAGAAGAATCAGGCACAG No data
Right 921888080 1:220326389-220326411 GGCACAGTGGTCACATATTCTGG No data
921888076_921888080 0 Left 921888076 1:220326366-220326388 CCAATGGCCTGTGAGAAGAATCA No data
Right 921888080 1:220326389-220326411 GGCACAGTGGTCACATATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921888080 Original CRISPR GGCACAGTGGTCACATATTC TGG Intergenic
No off target data available for this crispr