ID: 921888081

View in Genome Browser
Species Human (GRCh38)
Location 1:220326413-220326435
Sequence TTCCCAGAATAGTCCCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921888076_921888081 24 Left 921888076 1:220326366-220326388 CCAATGGCCTGTGAGAAGAATCA No data
Right 921888081 1:220326413-220326435 TTCCCAGAATAGTCCCATTGTGG No data
921888078_921888081 17 Left 921888078 1:220326373-220326395 CCTGTGAGAAGAATCAGGCACAG No data
Right 921888081 1:220326413-220326435 TTCCCAGAATAGTCCCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921888081 Original CRISPR TTCCCAGAATAGTCCCATTG TGG Intergenic
No off target data available for this crispr