ID: 921892847

View in Genome Browser
Species Human (GRCh38)
Location 1:220370380-220370402
Sequence CTGAGCCAGTGGCAAGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921892844_921892847 6 Left 921892844 1:220370351-220370373 CCAAATCTTCCACATGGAGTCAG No data
Right 921892847 1:220370380-220370402 CTGAGCCAGTGGCAAGTGCTAGG No data
921892845_921892847 -3 Left 921892845 1:220370360-220370382 CCACATGGAGTCAGTTTAAGCTG No data
Right 921892847 1:220370380-220370402 CTGAGCCAGTGGCAAGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921892847 Original CRISPR CTGAGCCAGTGGCAAGTGCT AGG Intergenic
No off target data available for this crispr