ID: 921892847 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:220370380-220370402 |
| Sequence | CTGAGCCAGTGGCAAGTGCT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 921892844_921892847 | 6 | Left | 921892844 | 1:220370351-220370373 | CCAAATCTTCCACATGGAGTCAG | No data | ||
| Right | 921892847 | 1:220370380-220370402 | CTGAGCCAGTGGCAAGTGCTAGG | No data | ||||
| 921892845_921892847 | -3 | Left | 921892845 | 1:220370360-220370382 | CCACATGGAGTCAGTTTAAGCTG | No data | ||
| Right | 921892847 | 1:220370380-220370402 | CTGAGCCAGTGGCAAGTGCTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 921892847 | Original CRISPR | CTGAGCCAGTGGCAAGTGCT AGG | Intergenic | ||
| No off target data available for this crispr | |||||