ID: 921893179

View in Genome Browser
Species Human (GRCh38)
Location 1:220372859-220372881
Sequence GAGCCACAGATGCTATCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921893179_921893182 -9 Left 921893179 1:220372859-220372881 CCTGTTGATAGCATCTGTGGCTC No data
Right 921893182 1:220372873-220372895 CTGTGGCTCTGGCCACAGGAAGG No data
921893179_921893185 13 Left 921893179 1:220372859-220372881 CCTGTTGATAGCATCTGTGGCTC No data
Right 921893185 1:220372895-220372917 GTGCATAATGGTGCTATCCCTGG No data
921893179_921893187 24 Left 921893179 1:220372859-220372881 CCTGTTGATAGCATCTGTGGCTC No data
Right 921893187 1:220372906-220372928 TGCTATCCCTGGGCTGCCACTGG No data
921893179_921893186 14 Left 921893179 1:220372859-220372881 CCTGTTGATAGCATCTGTGGCTC No data
Right 921893186 1:220372896-220372918 TGCATAATGGTGCTATCCCTGGG No data
921893179_921893183 1 Left 921893179 1:220372859-220372881 CCTGTTGATAGCATCTGTGGCTC No data
Right 921893183 1:220372883-220372905 GGCCACAGGAAGGTGCATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921893179 Original CRISPR GAGCCACAGATGCTATCAAC AGG (reversed) Intergenic
No off target data available for this crispr