ID: 921899472

View in Genome Browser
Species Human (GRCh38)
Location 1:220435250-220435272
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921899470_921899472 4 Left 921899470 1:220435223-220435245 CCAAAGTGACAGATCTCTAGACT No data
Right 921899472 1:220435250-220435272 GAGGTCACATCTAGACTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type