ID: 921901858

View in Genome Browser
Species Human (GRCh38)
Location 1:220459682-220459704
Sequence CAAGTTCAGGAGCTATTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
921901858_921901864 29 Left 921901858 1:220459682-220459704 CCCATCAATAGCTCCTGAACTTG No data
Right 921901864 1:220459734-220459756 TTTTCTAGTTCAGACTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
921901858 Original CRISPR CAAGTTCAGGAGCTATTGAT GGG (reversed) Intergenic
No off target data available for this crispr